Modulation of Lipogenesis and Glucose Consumption in HepG2 Cells and C2C12 Myotubes by Sophoricoside
Abstract
:1. Introduction
2. Results and Discussion
2.1. Sophoricoside Inhibited Lipid Accumulation in HepG2 Cells
2.2. Sophoricoside Decreased the Transcription of Lipogenesis-Related Transcription Factors and Their Target Genes
2.3. Sophoricoside Increases the Activity of AMPK
2.4. Sophoricoside Stimulates Glucose Uptake by C2C12 Myotubes
2.5. Sophoricoside Inhibits the Activities of α-Glucosidase and α-Amylase In Vitro and In Vivo
3. Experimental
3.1. Materials
3.2. Cell Culture
3.3. MTT Assay
3.4. Western Blot
3.5. Quantitative Real-Time PCR
Name | Forward (5'-3') | Reverse(5'-3') |
---|---|---|
SERBP-1a | tgctgaccgacatcgaagac | ccagcatagggtgggtcaa |
SREBP-1c | ccatggatgcactttcgaa | ccagcatagggtgggtcaa |
SREBP-2 | ctgcaacaacagacggtaatga | ccattggccgtttgtgtcag |
FAS | CGGTACGCGACGGCTGCCTG | GCTGCTCCACGAACTCAAACACCG |
ACC | TGATGTCAATCTCCCCGCAGC | TTGCTTCTTCTCTGTTTTCTCCCC |
HMGR | ggacccctttgcttagatgaaa | ccaccaagacctattgctctg |
β-actin | CCTGGCACCCAGCACAAT | GCCGATCCACACACGGAGTACT |
3.6. Glucose Uptake Assay
3.7. α-Glucosidase and α-Amylase Inhibition Assay
3.8. Animal Experiment
3.9. Statistics Analysis
4. Conclusions
Acknowledgments
Conflicts of Interest
References
- Smith-Spangler, C.M.; Bhattacharya, J.; Goldhaber-Fiebert, J.D. Diabetes, its treatment, and catastrophic medical spending in 35 develo** countries. Diabetes Care 2012, 35, 319–326. [Google Scholar] [CrossRef]
- McCall, K.D.; Schmerr, M.J.; Thuma, J.R.; James, C.B.; Courreges, M.C.; Benencia, F.; Malgor, R.; Schwartz, F.L. Phenylmethimazole suppresses dsRNA-induced cytotoxicity and inflammatory cytokines in murine pancreatic beta cells and blocks viral acceleration of type 1 diabetes in NOD mice. Molecules 2013, 18, 3841–3858. [Google Scholar] [CrossRef]
- Kumashiro, N.; Erion, D.M.; Zhang, D.; Kahn, M.; Beddow, S.A.; Chu, X.; Still, C.D.; Gerhard, G.S.; Han, X.; Dziura, J.; et al. Cellular mechanism of insulin resistance in nonalcoholic fatty liver disease. Proc. Natl. Acad. Sci. USA 2011, 108, 16381–16385. [Google Scholar] [CrossRef]
- D’Adamo, E.; Cali, A.M.; Weiss, R.; Santoro, N.; Pierpont, B.; Northrup, V.; Caprio, S. Central role of fatty liver in the pathogenesis of insulin resistance in obese adolescents. Diabetes Care 2010, 33, 1817–1822. [Google Scholar] [CrossRef]
- Poulsen, M.M.; Larsen, J.O.; Hamilton-Dutoit, S.; Clasen, B.F.; Jessen, N.; Paulsen, S.K.; Kjaer, T.N.; Richelsen, B.; Pedersen, S.B. Resveratrol up-regulates hepatic uncoupling protein 2 and prevents development of nonalcoholic fatty liver disease in rats fed a high-fat diet. Nutr. Res. 2012, 32, 701–708. [Google Scholar] [CrossRef]
- Guo, P.; Kai, Q.; Gao, J.; Lian, Z.Q.; Wu, C.M.; Wu, C.A.; Zhu, H.B. Cordycepin prevents hyperlipidemia in hamsters fed a high-fat diet via activation of AMP-activated protein kinase. J. Pharmacol. Sci. 2010, 113, 395–403. [Google Scholar] [CrossRef]
- Wan, C.W.; Wong, C.N.; Pin, W.K.; Wong, M.H.; Kwok, C.Y.; Chan, R.Y.; Yu, P.H.; Chan, S.W. Chlorogenic acid exhibits cholesterol lowering and fatty liver attenuating properties by up-regulating the gene expression of PPAR-alpha in hypercholesterolemic rats induced with a high-cholesterol diet. Phytother. Res. 2013, 27, 545–551. [Google Scholar] [CrossRef]
- Park, K.W.; Lee, J.E.; Park, K.M. Diets containing Sophora japonica L. prevent weight gain in high-fat diet-induced obese mice. Nutr. Res. 2009, 29, 819–824. [Google Scholar] [CrossRef]
- Kim, J.M.; Yun-Choi, H.S. Anti-platelet effects of flavonoids and flavonoid-glycosides from Sophora japonica. Arch. Pharm. Res. 2008, 31, 886–90. [Google Scholar] [CrossRef]
- Jung, C.H.; Zhou, S.; Ding, G.X.; Kim, J.H.; Hong, M.H.; Shin, Y.C.; Kim, G.J.; Ko, S.G. Antihyperglycemic activity of herb extracts on streptozotocin-induced diabetic rats. Biosci. Biotechnol. Biochem. 2006, 70, 2556–2559. [Google Scholar] [CrossRef]
- Chen, H.; Zhang, J.; Luo, J.; Lai, F.; Wang, Z.; Tong, H.; Lu, D.; Bu, H.; Zhang, R.; Lin, S. Antiangiogenic effects of oxymatrine on pancreatic cancer by inhibition of the NF-kappaB-mediated VEGF signaling pathway. Oncol. Rep. 2013, 30, 589–595. [Google Scholar]
- El-Halawany, A.M.; Chung, M.H.; Abdallah, H.M.; Nishihara, T.; Hattori, M. Estrogenic activity of a naringinase-treated extract of Sophora japonica cultivated in Egypt. Pharm. Biol. 2010, 48, 177–181. [Google Scholar] [CrossRef]
- Kandaswami, C.; Middleton, E., Jr. Free radical scavenging and antioxidant activity of plant flavonoids. Adv. Exp. Med. Biol. 1994, 366, 351–376. [Google Scholar] [CrossRef]
- Kim, S.J.; Lee, G.Y.; Jung, J.W.; Oh, S.R.; Ahn, E.M.; Kim, S.H.; Hong, S.H.; Um, J.Y. The ameliorative effect of sophoricoside on mast cell-mediated allergic inflammation in vivo and in vitro. Molecules 2013, 18, 6113–6127. [Google Scholar] [CrossRef]
- Xu, Y.; Chen, W.Z.; Du, N. Effects of sophoricoside and genistein on biological characteristics of osteoblasts. JCIM 2009, 7, 223–227. [Google Scholar]
- Lee, H.K.; Kim, H.S.; Kim, Y.J.; Kim, J.S.; Park, Y.S.; Kang, J.S.; Yuk, D.Y.; Hong, J.T.; Kim, Y.; Han, S.B. Sophoricoside isolated from Sophora japonica ameliorates contact dermatitis by inhibiting NF-kappaB signaling in B cells. Int. Immunopharm. 2013, 15, 467–473. [Google Scholar] [CrossRef]
- **ao, X.; Song, B.L. SREBP: A novel therapeutic target. Acta Biochim. Biophys. Sin. 2013, 45, 2–10. [Google Scholar] [CrossRef]
- Huang, Y.L.; Zhao, F.; Luo, C.C.; Zhang, X.; Si, Y.; Sun, Z.; Zhang, L.; Li, Q.Z.; Gao, X.J. SOCS3-mediated blockade reveals major contribution of JAK2/STAT5 signaling pathway to lactation and proliferation of dairy cow mammary epithelial cells in Vitro. Molecules 2013, 18, 12987–3002. [Google Scholar] [CrossRef]
- Lanaspa, M.A.; Cicerchi, C.; Garcia, G.; Li, N.; Roncal-Jimenez, C.A.; Rivard, C.J.; Hunter, B.; Andres-Hernando, A.; Ishimoto, T.; Sanchez-Lozada, L.G.; et al. Counteracting roles of AMP deaminase and AMP kinase in the development of fatty liver. PLoS One 2012, 7, e48801. [Google Scholar] [CrossRef]
- Shih, C.C.; Ciou, J.L.; Lin, C.H.; Wu, J.B.; Ho, H.Y. Cell suspension culture of Eriobotrya japonica regulates the diabetic and hyperlipidemic signs of high-fat-fed mice. Molecules 2013, 18, 2726–2753. [Google Scholar] [CrossRef]
- Muoio, D.M.; Seefeld, K.; Witters, L.A.; Coleman, R.A. AMP-activated kinase reciprocally regulates triacylglycerol synthesis and fatty acid oxidation in liver and muscle: Evidence that sn-glycerol-3-phosphate acyltransferase is a novel target. Biochem. J. 1999, 338, 783–791. [Google Scholar] [CrossRef]
- Li, Y.; Xu, S.; Mihaylova, M.M.; Zheng, B.; Hou, X.; Jiang, B.; Park, O.; Luo, Z.; Lefai, E.; Shyy, J.Y.; et al. AMPK phosphorylates and inhibits SREBP activity to attenuate hepatic steatosis and atherosclerosis in diet-induced insulin-resistant mice. Cell Metab 2011, 13, 376–388. [Google Scholar] [CrossRef]
- Chen, Y.G.; Li, P.; Yan, R.; Zhang, X.Q.; Wang, Y.; Zhang, X.T.; Ye, W.C.; Zhang, Q.W. Alpha-Glucosidase inhibitory effect and simultaneous quantification of three major flavonoid glycosides in Microctis folium. Molecules 2013, 18, 4221–4232. [Google Scholar] [CrossRef]
- Lordan, S.; Smyth, T.J.; Soler-Vila, A.; Stanton, C.; Ross, R.P. The alpha-amylase and alpha-glucosidase inhibitory effects of Irish seaweed extracts. Food Chem. 2013, 141, 2170–2176. [Google Scholar] [CrossRef]
- GraphPad Prism, version 4.0; GraphPad Software Inc.: San Diego, CA, USA, 2005.
- Zhang, X.; Wu, C.; Wu, H.; Sheng, L.; Su, Y.; Luan, H.; Sun, G.; Sun, X.; Tian, Y.; Ji, Y.; et al. Anti-hyperlipidemic effects and potential mechanisms of action of the caffeoylquinic acid-rich Pandanus tectorius fruit extract in hamsters fed a high fat-diet. PLoS One 2013, 8, e61922. [Google Scholar]
- Wu, C.; Feng, J.; Wang, R.; Liu, H.; Yang, H.; Rodriguez, P.L.; Qin, H.; Liu, X.; Wang, D. HRS1 acts as a negative regulator of abscisic acid signaling to promote timely germination of Arabidopsis seeds. PLoS One 2012, 7, e35764. [Google Scholar]
- Alonso-Castro, A.J.; Zapata-Bustos, R.; Dominguez, F.; Garcia-Carranca, A.; Salazar-Olivo, L.A. Magnolia dealbata Zucc and its active principles honokiol and magnolol stimulate glucose uptake in murine and human adipocytes using the insulin-signaling pathway. Phytomedicine 2011, 18, 926–933. [Google Scholar] [CrossRef]
- Wu, C.; Shen, J.; He, P.; Chen, Y.; Li, L.; Zhang, L.; Li, Y.; Fu, Y.; Dai, R.; Meng, W.; et al. The alpha-glucosidase inhibiting isoflavones isolated from belamcanda chinensis leaf extract. Rec. Nat. Prod. 2012, 6, 110–120. [Google Scholar]
- Wan, L.S.; Chen, C.P.; **ao, Z.Q.; Wang, Y.L.; Min, Q.X.; Yue, Y.; Chen, J. In vitro and in vivo anti-diabetic activity of Swertia kouitchensis extract. J. Ethnopharmacol. 2013, 147, 622–630. [Google Scholar] [CrossRef]
- SPSS, version 13.0; SPSS Inc.: Chicago, IL, USA, 2005.
- Sample Availability: Not available.
© 2013 by the authors; licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution license (http://creativecommons.org/licenses/by/3.0/).
Share and Cite
Wu, C.; Luan, H.; Wang, S.; Zhang, X.; Wang, R.; **, L.; Guo, P.; Chen, X. Modulation of Lipogenesis and Glucose Consumption in HepG2 Cells and C2C12 Myotubes by Sophoricoside. Molecules 2013, 18, 15624-15635. https://doi.org/10.3390/molecules181215624
Wu C, Luan H, Wang S, Zhang X, Wang R, ** L, Guo P, Chen X. Modulation of Lipogenesis and Glucose Consumption in HepG2 Cells and C2C12 Myotubes by Sophoricoside. Molecules. 2013; 18(12):15624-15635. https://doi.org/10.3390/molecules181215624
Chicago/Turabian StyleWu, Chongming, Hong Luan, Shuai Wang, Xue Zhang, Ran Wang, Lifeng **, Peng Guo, and ** Chen. 2013. "Modulation of Lipogenesis and Glucose Consumption in HepG2 Cells and C2C12 Myotubes by Sophoricoside" Molecules 18, no. 12: 15624-15635. https://doi.org/10.3390/molecules181215624