Melatonin Improves Heat Tolerance in Kiwifruit Seedlings through Promoting Antioxidant Enzymatic Activity and Glutathione S-Transferase Transcription
Abstract
:1. Introduction
2. Results
2.1. Seedling Morphology, H2O2 and Proline Content in Heat-Stressed Kiwifruit
2.2. POD, CAT, and SOD Activities under Heat Stress
2.3. Ascorbic Acid Content and AsA-GSH-Cycle Enzymatic Activity under Heat Stress
2.4. Expression Profile of GST under Heat Stress
3. Discussion
4. Materials and Methods
4.1. Plant Materials and Treatment
4.2. Assays of H2O2 Content and Antioxidant Enzyme Activity
4.3. Extraction and Assay of AsA Content and AsA-GSH Cycle Enzymes
4.4. Quantitative Real-Time PCR for Profiling GST Expression
4.5. Expression Analysis of GST Genes Based on Transcriptome Data
Acknowledgments
Author Contributions
Sample Availability: Samples of the compounds are not available from the authors. |
Gene Locus | Forward Primer | Reverse Primer |
---|---|---|
ACHN160841 | GGTGTTGATACATAACGGAAAG | TGGACAATGATGAGGGACT |
Actin1 | GCAGGAATCCATGAGACTACC | GTCTGCGATACCAGGGAACAT |
© 2018 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Liang, D.; Gao, F.; Ni, Z.; Lin, L.; Deng, Q.; Tang, Y.; Wang, X.; Luo, X.; **a, H. Melatonin Improves Heat Tolerance in Kiwifruit Seedlings through Promoting Antioxidant Enzymatic Activity and Glutathione S-Transferase Transcription. Molecules 2018, 23, 584. https://doi.org/10.3390/molecules23030584
Liang D, Gao F, Ni Z, Lin L, Deng Q, Tang Y, Wang X, Luo X, **a H. Melatonin Improves Heat Tolerance in Kiwifruit Seedlings through Promoting Antioxidant Enzymatic Activity and Glutathione S-Transferase Transcription. Molecules. 2018; 23(3):584. https://doi.org/10.3390/molecules23030584
Chicago/Turabian StyleLiang, Dong, Fan Gao, Zhiyou Ni, Li** Lin, Qunxian Deng, Yi Tang, Xun Wang, **an Luo, and Hui **a. 2018. "Melatonin Improves Heat Tolerance in Kiwifruit Seedlings through Promoting Antioxidant Enzymatic Activity and Glutathione S-Transferase Transcription" Molecules 23, no. 3: 584. https://doi.org/10.3390/molecules23030584