Antiproliferative and Pro-Apoptotic Effects of a Phenolic-Rich Extract from Lycium barbarum Fruits on Human Papillomavirus (HPV) 16-Positive Head Cancer Cell Lines
Abstract
:1. Introduction
2. Results
2.1. Chemical Characterization of L. Barbarum Extract
2.2. Antiproliferative Activity and SI of L. barbarum Extract
2.3. L. barbarum Induces G1/S Phase Arrest in SCC090 Cell Lines in a Dose-Dependent Manner
2.4. L. barbarum Induces Downregulation of Viral Oncoproteins E6 and E7 and Enhances p53 Levels in SCC090 Cell Line
2.5. L. barbarum Alters the Expression of Cell cycle Regulatory Proteins
3. Discussion
4. Materials and Methods
4.1. Botanical Extracts
4.2. Chemical Characterization of L. barbarum Extract
4.2.1. Measurements of Total Phenolic and Total Flavonoid Contents
4.2.2. Liquid Chromatography-Mass Spectrometry Analysis
4.3. In Vitro Culture of SCC090 Cells and CAL 27 Cells
4.4. Antiproliferative Activity Assay
4.5. Selectivity Index Analysis
4.6. Cell Cycle Analysis
4.7. RNA Extraction and RT-PCR Analysis
4.8. Immunohistochemistry
4.9. Data Analysis
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
Sample Availability
References
- De, C.; Ferreira, C.; Dufloth, R.; de Carvalho, A.C.; Reis, R.M.; Santana, I.; Carvalho, R.S.; Gama, R.R. Correlation of P16 Immunohistochemistry with Clinical and Epidemiological Features in Oropharyngeal Squamous-Cell Carcinoma. PLoS ONE 2021, 16, e0253418. [Google Scholar]
- Dalla Torre, D.; Burtscher, D.; Edlinger, M.; Sölder, E.; Widschwendter, A.; Rasse, M.; Puelacher, W. Comparison of the Prevalence of Human Papilloma Virus Infection in Histopathologically Confirmed Premalignant Oral Lesions and Healthy Oral Mucosa by Brush Smear Detection. Oral Surg. Oral Med. Oral Pathol. Oral Radiol. 2015, 119, 333–339. [Google Scholar] [CrossRef] [PubMed]
- Adams, A.K.; Wise-Draper, T.M.; Wells, S.I. Human Papillomavirus Induced Transformation in Cervical and Head and Neck Cancers. Cancers 2014, 6, 1793–1820. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Sundberg, J.; Öhman, J.; Korytowska, M.; Wallström, M.; Kjeller, G.; Andersson, M.; Horal, P.; Lindh, M.; Giglio, D.; Kovács, A.; et al. High-Risk Human Papillomavirus in Patients with Oral Leukoplakia and Oral Squamous Cell Carcinoma—A Multi-Centre Study in Sweden, Brazil and Romania. Oral Dis. 2021, 27, 183–192. [Google Scholar] [CrossRef] [PubMed]
- Nogues, J.C.; Fassas, S.; Mulcahy, C.; Zapanta, P.E. Human Papillomavirus-Associated Head and Neck Cancer. J. Am. Board Fam. Med. 2021, 34, 832–837. [Google Scholar] [CrossRef] [PubMed]
- Best, S.R.; Niparko, K.J.; Pai, S.I. Biology of Human Papillomavirus Infection and Immune Therapy for HPV-Related Head and Neck Cancers. Otolaryngol. Clin. North Am. 2012, 45, 807–822. [Google Scholar] [CrossRef] [Green Version]
- Ottria, L.; Candotto, V.; Cura, F.; Baggi, L.; Arcuri, C.; Nardone, M.; Gaudio, R.M.; Gatto, R.; Spadari, F.; Carinci, F. Human Papilloma Virus Associated with Oral Cancer and Preventive Strategies: The Role of Vaccines. J. Biol. Regul. Homeost. Agents 2018, 32, 61–65. [Google Scholar]
- Tuttle, S.W.; Hertan, L.; Daurio, N.A.; Porter, S.E.; Kaushik, C.; Li, D.; Myamoto, S.; Lin, A.; O’Malley, B.W.; Koumenis, C. The Chemopreventive and Clinically Used Agent Curcumin Sensitizes HPV—but Not HPV+ HNSCC to Ionizing Radiation, in Vitro and in a Mouse Orthotopic Model. Cancer Biol. Ther. 2012, 13, 575–584. [Google Scholar] [CrossRef] [Green Version]
- Ho, P.S.; Chen, P.L.; Warnakulasuriya, S.; Shieh, T.Y.; Chen, Y.K.; Huang, I.Y. Malignant Transformation of Oral Potentially Malignant Disorders in Males: A Retrospective Cohort Study. BMC Cancer 2009, 9, 260. [Google Scholar] [CrossRef] [Green Version]
- Koyfman, S.A.; Ismaila, N.; Crook, D.; D’Cruz, A.; Rodriguez, C.P.; Sher, D.J.; Silbermins, D.; Sturgis, E.M.; Tsue, T.T.; Weiss, J.; et al. Management of the Neck in Squamous Cell Carcinoma of the Oral Cavity and Oropharynx: ASCO Clinical Practice Guideline. J. Clin. Oncol. 2019, 37, 1753–1774. [Google Scholar] [CrossRef]
- Kao, H.K.; Abdelrahman, M.; Huang, Y.; Tsai, C.H.; Barrera, M.J.; Tsang, N.M.; Couves, A.J.; Cheng, M.H.; Chang, K.P. Multiple Concomitant Oral Cavity Cancers: Incidence, Management, and Outcomes. J. Surg. Oncol. 2017, 115, 835–841. [Google Scholar] [CrossRef] [PubMed]
- Warnakulasuriya, S.; Ariyawardana, A. Malignant Transformation of Oral Leukoplakia: A Systematic Review of Observational Studies. J. Oral Pathol. Med. 2016, 45, 155–166. [Google Scholar] [CrossRef] [PubMed]
- Thomford, N.E.; Senthebane, D.A.; Rowe, A.; Munro, D.; Seele, P.; Maroyi, A.; Dzobo, K. Natural Products for Drug Discovery in the 21st Century: Innovations for Novel Drug Discovery. Int. J. Mol. Sci. 2018, 19, 1578. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Cragg, G.M.; Pezzuto, J.M. Natural Products as a Vital Source for the Discovery of Cancer Chemotherapeutic and Chemopreventive Agents. Med. Princ. Pract. 2016, 25, 41–59. [Google Scholar] [CrossRef]
- Sansone, F.; Mencherini, T.; Picerno, P.; Lauro, M.R.; Cerrato, M.; Aquino, R.P. Development of Health Products from Natural Sources. Curr. Med. Chem. 2019, 26, 4606–4630. [Google Scholar] [CrossRef]
- Katiyar, S.K. Emerging Phytochemicals for the Prevention and Treatment of Head and Neck Cancer. Molecules 2016, 21, 1610. [Google Scholar] [CrossRef] [Green Version]
- Tewari, D.; Rawat, P.; Singh, P.K. Adverse Drug Reactions of Anticancer Drugs Derived from Natural Sources. Food Chem. Toxicol. 2019, 123, 522–535. [Google Scholar] [CrossRef]
- Zeng, P.; Li, J.; Chen, Y.; Zhang, L. The Structures and Biological Functions of Polysaccharides from Traditional Chinese Herbs. Prog. Mol. Biol. Transl. Sci. 2019, 163, 423–444. [Google Scholar] [CrossRef]
- Yao, X.; Peng, Y.; Xu, L.-J.; Li, L.; Wu, Q.-L.; ** and Analysis of HPV16 Integration Sites in a Head and Neck Cancer Cell Line. Int. J. Cancer 2004, 110, 701–709. [Google Scholar] [CrossRef] [PubMed]
- Page, B.; Page, M.; Noel, C. A New Fluorometric Assay for Cytotoxicity Measurements in Vitro. Int. J. Oncol. 1993, 3, 473–476. [Google Scholar] [CrossRef] [PubMed]
- Da’i, M.; Meilinasary, K.A.; Suhendi, A.; Haryanti, S. Selectivity Index of Alpinia Galanga Extract and 1′-Acetoxychavicol Acetate on Cancer Cell Lines. Indones. J. Cancer Chemoprevention 2019, 10, 95. [Google Scholar] [CrossRef]
- Prayong, P.; Barusrux, S.; Weerapreeyakul, N. Cytotoxic Activity Screening of Some Indigenous Thai Plants. Fitoterapia 2008, 79, 598–601. [Google Scholar] [CrossRef]
- Pfaffl, M.W. A New Mathematical Model for Relative Quantification in Real-Time RT-PCR. Nucleic Acids Res. 2001, 29, e45. [Google Scholar] [CrossRef]
- Allred, D.C.; Harvey, J.M.; Berardo, M.; Clark, G.M. Prognostic and Predictive Factors in Breast Cancer by Immunohistochemical Analysis. Mod. Pathol. 1998, 11, 155–168. [Google Scholar]
# | rt a | RA b | m/zc | Molecular Formula d | Error (ppm) e | Fragment Ions f | Name g |
---|---|---|---|---|---|---|---|
(min) | (%) | ([M + H]+) | |||||
1 | 2.22 | 21.03 | 337.0938 | C16H17O8 | 4.45 | 175.0621 | 5-O-caffeoylshikimic acid |
2 | 2.37 | 3.57 | 607.1795 | C32H31O12 | −3.46 | 305.1018, 125.0611 | 4′,4′′′-O-dimethylprocyanidin B |
3 | 2.7 | 4.03 | 291.0854 | C15H15O6 | −5.02 | 182.0579 | catechin |
4 | 3.9 | 0.64 | 331.0805 | C17H15O7 | −3.87 | 195.0293 | 3′,4′-O-dimethylquercetin |
5 | 5.03 | 0.81 | 301.0721 | C14H13O6 | −2.99 | 192.0433 | 7-methoxyluteolin |
6 | 7.92 | 34.87 | 481.1702 | C23H29O11 | −1.66 | 319.1172, 197.0802 | 4′,7-O-dimethylcatechin 3-O-glucoside |
7 | 8.03 | 3.85 | 463.1228 | C22H23O11 | −2.59 | 301.0718, 179.0351 | 4′-O-methylcyanidin 3-O-glucoside |
8 | 8.48 | 6.36 | 611.1621 | C27H31O16 | 1.46 | 449.1072, 303.0511, 311.1331 | quercetin 3-O-rutinoside (rutin) |
9 | 8.91 | 4.52 | 481.1723 | C23H29O11 | 2.70 | 319.1163, 197.0806 | 4′,5-O-dimethylcatechin 3-O-glucoside |
10 | 9.79 | 0.69 | 300.1246 | C17H18NO4 | −3.33 | 163.0384, 137.0855 | N-caffeoyl tyramine |
11 | 10.22 | 1.45 | 284.1279 | C17H18NO3 | −2.82 | 147.0455, 137.0851 | N-coumaroyl tyramine |
12 | 10.26 | 12.02 | 314.1399 | C18H20NO4 | −2.23 | 177.0563, 137.0853 | N-feruloyl tyramine |
13 | 10.81 | 2.04 | 316.1195 | C17H18NO5 | −3.16 | 177.0559, 153.0779 | N-caffeoyl dopamine |
14 | 11.58 | 1.25 | 344.1486 | C19H22NO5 | 3.49 | 163.0387, 167.0958 | N-feruloyl 3-O-methyldopamine |
15 | 13.47 | 2.87 | 625.2539 | C36H37N2O8 | 1.76 | 489.1776, 352.0958, 137.0861 | grossamide |
SCC090 a | CAL27 a | HGnF a | |||
---|---|---|---|---|---|
Treatments | IC50 b | SI c | IC50 a | SI c | IC50 a |
L. barbarum Extract | 454.6 | 1.4 | 266.2 | 2.4 | 626.5 |
C. sinensis Extract | 371.6 | 1.3 | 316.2 | 1.5 | 471.6 |
Cisplatin | 5.84 | - | - | - | - |
Primer | Sequence (5′ to 3′) | Genbank Sequence ID | Product Size (bp) |
HPV 16 E6-F | GCACCAAAAGAGAACTGCAATGTT | MN705373.1 | |
HPV 16 E6-R | AGTCATATACCTCACGTCGCAGTA | 152 | |
HPV 16 E7-F | CAAGTGTGACTCTACGCTTCGG | MK343362.1 | |
HPV 16 E7-R | GTGGCCCATTAACAGGTCTTCCAA | 81 | |
p53-F | CAGCATCTTATCCGAGTG | MG595993.1 | 198 |
p53-R | CAGTGTGATGATGGTGAG |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Peraza-Labrador, A.; Buitrago, D.M.; Coy-Barrera, E.; Perdomo-Lara, S.J. Antiproliferative and Pro-Apoptotic Effects of a Phenolic-Rich Extract from Lycium barbarum Fruits on Human Papillomavirus (HPV) 16-Positive Head Cancer Cell Lines. Molecules 2022, 27, 3568. https://doi.org/10.3390/molecules27113568
Peraza-Labrador A, Buitrago DM, Coy-Barrera E, Perdomo-Lara SJ. Antiproliferative and Pro-Apoptotic Effects of a Phenolic-Rich Extract from Lycium barbarum Fruits on Human Papillomavirus (HPV) 16-Positive Head Cancer Cell Lines. Molecules. 2022; 27(11):3568. https://doi.org/10.3390/molecules27113568
Chicago/Turabian StylePeraza-Labrador, Alberto, Diana Marcela Buitrago, Ericsson Coy-Barrera, and Sandra J. Perdomo-Lara. 2022. "Antiproliferative and Pro-Apoptotic Effects of a Phenolic-Rich Extract from Lycium barbarum Fruits on Human Papillomavirus (HPV) 16-Positive Head Cancer Cell Lines" Molecules 27, no. 11: 3568. https://doi.org/10.3390/molecules27113568