Identification and Expression Analysis of Candidate Genes Associated with Defense Responses to Phytophthora capsici in Pepper Line “PI 201234”
Abstract
:1. Introduction
2. Results
2.1. Sequencing Output and Map** Reads to the Genome
Class | Library A | Library CK | ||||
---|---|---|---|---|---|---|
Number | Total Length (bp) | Percentage (%) | Number | Total Length (bp) | Percentage (%) | |
Raw reads | 79,250,598 | 7,925,059,800 | 75,339,602 | 7,533,960,200 | ||
Clean reads | 76,015,888 | 7,152,478,994 | 95.92 | 72,130,988 | 6,782,519,810 | 95.74 |
Map** to genome | 71,904,454 | 94.60 | 67,803,241 | 94.00 | ||
Total map** position | 86,610,410 | 86,962,176 |
Class | Number | Percentage (%) |
---|---|---|
Total genes | 30,106 | 100 |
Expressed genes | 30,090 | 99.95 |
Expressed in library A | 29,988 | 99.66 |
Expressed in library CK | 29,972 | 99.61 |
Expressed both | 29,870 | 99.27 |
Expressed only in library A | 118 | 0.39 |
Expressed only in library CK | 102 | 0.34 |
2.2. Kyoto Encyclopedia of Genes and Genomes (KEGG) Functional Classifications
2.3. Functional Classifications via Interpro and Gene Ontology (GO)
2.4. Identification and Annotation of Potential Differentially Expressed Genes
2.5. RNA-Seq Validation and Selection of Potential Defense-Related Genes
Gene Name | Reference Gene | Annotation | Primer (5'–3') |
---|---|---|---|
XLOC_023615 | Capana06g000792 | SWEET sugar transporter | F: ATTGCTCCAAAGCCACCACC |
R: TGGCAGCATCGTCTCGTTCA | |||
XLOC_004633 | Capana01g001100 | Major intrinsic protein, conserved site | F: TTGTGGCTGTTTCAGTGTCA |
R: GGTAGCAATCTTGAGGAGGA | |||
XLOC_021386 | Capana05g000172 | Proteinase inhibitor I25, cystatin, conserved region | F: AGGCGAAGACAAATCTGGAAT |
R: TGCTAAATAGTTATGTGGCGAGTC | |||
XLOC_021757 | Capana05g001613 | Plant peroxidase | F: GTATTACTCGGCAGAAGGGACTC |
R: GTGGTTGGGCTTGTGGTGT | |||
XLOC_021200 | Capana05g002178 | Plant peroxidase | F: CTTTTCCACGATTGTTTTGTTAGG |
R: CGACCTGCTGGCACTGAAT | |||
XLOC_021142 | Capana05g001951 | AP2/ERF domain | F: TCCTCATACCTAAACGAACCCA |
R: AGTTGTTGTCGTGTGTTGGATTG | |||
XLOC_021821 | Capana05g001948 | AP2/ERF domain | F: TTGAAAGAATCTCGGACACCC |
R: GAAATTGAACGGCGACCAG |
3. Discussion
3.1. RNA-Seq Dataset Analysis
3.2. Potential Defense Related Genes against P. capsici
3.2.1. Cell Wall Modification
3.2.2. Phytoalexins
3.2.3. Phytohormones
3.2.4. Analysis of a Novel Gene on Chromosome 5 in the Zunla-1 Genome
4. Experimental Section
4.1. Biological Material for RNA-Seq
4.2. Biological Material for Selection of Candidate Genes
4.3. Inoculation Procedure and Sample Collection
4.4. RNA Extraction and Library Preparation for Transcriptome Sequencing
4.5. Transcriptome Data Processing and Assembly
4.6. Functional Annotation and Classification
4.7. Detection of Differentially Expressed Genes
4.8. RNA-Seq Validation via qPCR
4.9. Selection of Potential Defense-Related Genes
5. Conclusions
Supplementary Materials
Acknowledgments
© 2015 by the authors; licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Wang, P.; Liu, X.; Guo, J.; Liu, C.; Fu, N.; Shen, H. Identification and Expression Analysis of Candidate Genes Associated with Defense Responses to Phytophthora capsici in Pepper Line “PI 201234”. Int. J. Mol. Sci. 2015, 16, 11417-11438. https://doi.org/10.3390/ijms160511417
Wang P, Liu X, Guo J, Liu C, Fu N, Shen H. Identification and Expression Analysis of Candidate Genes Associated with Defense Responses to Phytophthora capsici in Pepper Line “PI 201234”. International Journal of Molecular Sciences. 2015; 16(5):11417-11438. https://doi.org/10.3390/ijms160511417
Chicago/Turabian StyleWang, **yong, **aodan Liu, **ju Guo, Chen Liu, Nan Fu, and Huolin Shen. 2015. "Identification and Expression Analysis of Candidate Genes Associated with Defense Responses to Phytophthora capsici in Pepper Line “PI 201234”" International Journal of Molecular Sciences 16, no. 5: 11417-11438. https://doi.org/10.3390/ijms160511417