Genome-Wide Identification and Analysis of Anthocyanidin Reductase Gene Family in Lychee (Litchi chinensis Sonn.)

Abstract

Anthocyanidin reductase (ANR) is a key enzyme regulating anthocyanin synthesis and accumulation in plants. Here, lychee ANR genes were globally identified, their sequence and phylogenetic characteristics were analyzed, and their spatiotemporal expression patterns were characterized. A total of 51 ANR family members were identified in the lychee genome. The length of the encoded amino acid residues ranged from 87 aa to 289 aa, the molecular weight ranged from 9.49 KD to 32.40 KD, and the isoelectric point (pI) ranged from 4.83 to 9.33. Most of the members were acidic proteins. Most members of the LcANR family were located in the cytoplasm. The 51 LcANR family members were unevenly distributed in 11 chromosomes, and their exons and motif conserved structures were significantly different from each other. Promoters in over 90% of LcANR members contained anaerobically induced response elements, and 88% contained photoresponsive elements. Most LcANR family members had low expression in nine lychee tissues and organs (root, young leaf, bud, female flower, male flower, pericarp, pulp, seed, and calli), and some members showed tissue-specific expression patterns. The expression of one gene, LITCHI029356.m1, decreased with the increase of anthocyanin accumulation in ‘Feizixiao’ and ‘Ziniangxi’ pericarp, which was negatively correlated with pericarp coloring. The identified LcANR gene was heterologously expressed in tobacco K326, and the function of the LcANR gene was verified. This study provides a basis for the further study of LcANR function, particularly the role in lychee pericarp coloration.

1. Introduction

Lychee (Litchi chinensis Sonn.), also named litchi or leechee, is an important fruit crop in tropical and subtropical regions around the world. This delicate fruit is cherished for its succulent edible portion and it plays a pivotal role in the local economy [1] of countries such as China [2], India, and Thailand, where it is widely cultivated and forms an integral part of both domestic consumption and international trade. For example, there were 527,000 hectares lychee in 2023In China [3]. Lychee cultivation contributes enormously to the livelihood of many small-scale farmers and agribusinesses, making it a vital crop with far-reaching economic and cultural significance.

The pericarp color of a lychee is one of the key traits from the consumer perspective [4]. Customers often make a purchasing decision based on the visual appeal of the pericarp, and thus the pericarp color often influences shop** behavior, causing participants in the fruit supply chain to associate rich pericarp colors with the optimal commercial value of a particular fruit [5]. For lychees, the trait of red pericarp serves as a key visual cue for consumers [6]. This identifiable and appealing hue is often associated with a specific variety and can be a mark of higher quality fruit; thus, it is often used by retailers as a standard to attract customers, making it a highly coveted trait in lychee cultivation. Furthermore, the appeal of the red pericarp color extends into the realm of lychee agricultural practices and breeding programs. In the field of lychee breeding, predecessors have conducted research on improving the coloring rate of lychees and making the fruit color bright red by spraying exogenous hormones [7,8,9], changing lighting [10,11] or temperature [12], and achieving changes in the color of lychee skin after ripening.

The red pericarp color of a lychee is primarily a result of the anthocyanin accumulation in the pericarps, which is what gives the fruit its distinctive appearance [13]. Anthocyanins are a group of pigments responsible for the red, purple, and blue colors in many fruits and vegetables. However, the specific mechanisms and factors that regulate the biosynthesis and accumulation of anthocyanins in the lychee pericarp remain largely unknown. In fact, the mechanisms underlying anthocyanin synthesis have been the subject of extensive study in model plants and other fruit crops. The biosynthetic pathway of anthocyanins involves a series of enzymatic reactions that convert simple molecules into complex pigments [14,15,16]. Researchers have identified key regulatory genes and enzymes involved in this process, shedding light on how plants produce and accumulate anthocyanins in response to environmental cues and developmental signals. It was found that chalcone synthase (CHS) [17] is the first key enzyme in anthocyanin synthesis pathway [15,18], followed by naringin chalcone isomerase (CHI), flavanone 3-hydroxylase (F3H), dihydroflavonol-4-reductase (DFR), and anthocyanidin synthase (ANS) under continuous action to form anthocyanins [19,20], while anthocyanidin reductase (ANR) [21] is the key enzyme for the synthesis of proanthocyanidin (PC). PC can be generated under the catalysis of ANR after the formation of anthocyanin. UFGT can catalyze anthocyanins to stable anthocyanins with glycosides. Stable anthocyanins with glycosides cannot be catalyzed by ANR to generate PC [22,23]. In fact, ANR plays a negative regulatory role in anthocyanin biosynthesis. Studies have shown that the absence of ANR promotes anthocyanin synthesis and increases anthocyanin content in Arabidopsis [24,25]. The ANR gene has been identified in tea tree [26,27,28], blueberry [29], apple [30], grape [31,32,33], peach [34], mango [35], and safflower [36], among other plants. In the study on the postharvest physiology of lychee, laccase was found to play a catalytic role in pericarp browning [37]. The substrate for pericarp browning is PC [38,39,40]. Therefore, the activity of ANR affects the degree of pericarp browning after fruit picking [41,42]. In the previous study of pericarp browning, five ANR family members were identified in lychee [43,44]. However, the ANR family members in lychee have not been studied in detail.

The FZX and ZNX used for genome assembly are known diploid lychees. In this study, the lychee ANR family members were comprehensively identified from the lychee reference genome. A total of three segmental-duplicated gene pairs with six LcANR genes were also identified on lychee chromosomes (LITCHI014912.m1&LITCHI003640.m1, LITCHI022853.m1&LITCHI025537.m1, LITCHI013339.m1&LITCHI029352.m1). The sequence and protein physicochemical characteristics were analyzed. The expression pattern in different lychee tissues, as well as in the pericarp of two lychee varieties at different coloring stage, was investigated. These results provide a basis for research on lychee pericarp coloring and the function of ANR genes.

2. Materials and Methods

2.1. Experimental Materials

From March to June in 2020 and 2023, the fruits of the ‘Feizixiao’ (FZX) and ‘Ziniangxi’ (ZNX) lychee tree were collected at Yongfa Lychee Research Demonstration Base of Tropical Fruit Research Institute of Hainan Academy of Agricultural Sciences. We chose these two varieties because of their color at harvest maturity: FZX was poorly colored while ZNX was almost completely red (Figure 1). The two varieties had nearly the same flowering time. The fruit samples were collected once a week, beginning on the 10th day after full blooming (DAB). Twenty similar fruits were selected at 10th DAB as reference fruit. Samples were collected every 7 days. Only fruits that were similar in size to the reference fruit were collected. The fruit samples were shipped back to the laboratory within 2 h of collection. They were carefully separated into pericarp, seeds, and pulp, and each part was frozen in liquid nitrogen and then stored at −80 ℃ for further use. Twenty fruits were set as a repeat, and three repeats were set for each sampling. In this research, we named the sampling date of 10th DAB of ZNX and FZX as Z1 and F1, respectively. The subsequent samples were named as Z2, F2, and so on. FZX fruit ripened at F9 stage, and ZNX fruit ripened at Z12 stage.

In March 2020, the buds and young leaves of spring branches, female flowers, male flowers, and the white roots of air-layering seedlings of FZX lychee were picked at the same place. The embryonic calli, induced and preserved as described by Wang [45], were also sampled. These materials were frozen in liquid nitrogen immediately after sampling and then stored at −80 °C for further use.

2.2. Identification and Physicochemical Properties of Anthocyanidin Reductase Gene Family in Lychee Genome

First, we found the published ANR gene (AT1G61720) [24,25] in Arabidopsis thaliana, and we found the conserved domain of ANR (PF01370) in the Arabidopsis genome database (https://www.arabidopsis.org/, accessed on 11 July 2023). The whole genome protein sequence of lychee was downloaded from the whole genome database of lychee. The lychee ANR gene ID containing (PF01370) was found from the data downloaded from the lychee genome database. In addition, the gene sequences of lychee ANR family members and lychee gff3 files were downloaded from the lychee genome database.

The lychee protein sequence was derived from the lychee genome database [46] (http://www.sapindaceae.com/, accessed on 12 July 2023). The hidden Markov model (PF01370) was obtained by Arabidopsis ANR [24] in Pfam (http://pfam.xfam.org/, accessed on 12 July 2023). The HMMER3.0 program was used to search the lychee protein sequence in the database to obtain candidate genes for preliminary screening. SMART (https://smart.embl-heidelberg.de/, accessed on 13 July 2023). ExPASy (https://www.expasy.org/, accessed on 13 July 2023) was used to analyze the physical and chemical properties of LcANR family members. Molecular Bioinformatics Center (http://cello.life.nctu.edu.tw, accessed on 13 July 2023) was used to predict subcellular localization and to predict the candidate gene family.

2.3. Amino Acid Sequence Alignment, Gene Structure Analysis, and Chromosome Localization of Lychee ANR Family Members

The LcANR family protein sequence from the lychee genome database [46] (https://data.mendeley.com/datasets/kggzfwpdr9/1, accessed on 7 August 2023) was obtained from the lychee genome for amino acid lychee genome database sequence alignment. The gene structure analysis of the ANR family in lychee was obtained by downloading the gff3 file from the lychee gene database and visualizing it by using the TBtools software analysis tool. TBtools and (http://meme-suite.org/, accessed on 8 August 2023) were used to analyze the domain of the LcANR family (https://tbtools.updatestar.com/, accessed on 8 August 2023). Map Chart Creator V2.0 (https://mapchart.net/, accessed on 10 August 2023) was used for chromosome localization analysis. Properties of ANR family members in litchi are shown in Table S1.

2.4. Construction of Lychee Genome LcANR Family Phylogenetic Tree

The whole protein sequence of Arabidopsis thaliana was downloaded from the Arabidopsis genome database (https://www.arabidopsis.org/, accessed on 20 August 2023), and the Apple genome database (http://bioinfo.bti.cornell.edu/ftp/Apple_genome/genome/haploid/Gala/, accessed on 21 August 2023); tea plant and grape information was obtained from NCBI (http://www.ncbi.nlm.nih.gov/, accessed on 22 August 2023). The ANR gene ID containing (PF01370) was found from the data of the whole genome protein sequence of these species. The protein sequences used to construct the evolutionary tree include 38 Arabidopsis ANR family members, 83 tea ANR family members, 68 apple ANR family members, 57 grape ANR family members, and 51 lychee ANR family members. The genes with the same domain as those identified in lychee were further analyzed by near-source species and model plants. In this phylogenetic tree, the branch of Arabidopsis ANR gene AT1G61720, which has been reported many times [24,25], was extracted to further determine the function of the LcANR gene in lychee. MUSCLEv3.8.31 was used to construct the ANR family phylogenetic tree of lychee, tea, apple, grape, and Arabidopsis.

2.5. Analysis of Cis-Acting Elements in Lychee LcANR

To understand the structure of LcANR genes, the online program MEME (https://meme-suite.org/meme/tools/meme, accessed on 18 September 2023) was commonly applied to analyze the conserved motifs. We downloaded domains from the NCBI Conserved Domain Database. The online website PlantCARE (http://bioinformatics.psb.ugent.be/webtools/plantcare/html/, accessed on 21 September 2023) was applied to predict the cis-acting elements within 2000 bp upstream of all LcANR genes [47]. We obtained intron/exon structure information from the lychee gff3 file. genes [46]. The visualization was performed with TBtools software.

2.6. Expression Analysis of Lychee ANR Family Members in the Lychee Transcriptomes

In our ongoing research, we used transcriptome data from various tissues, including pericarp at Z2, Z5, Z8, Z12, F2, F5, and F9 stage, and tissues of FZX such as seed, pulp, pericarp from matured fruit, leaves, buds, male flower, female flower, white roots of air-layering seedlings, and embryonic calli. The expression patterns of the ANR gene family were obtained by analyzing the transcriptome data and confirmed by qRT-PCR with random selected genes. Each sample had 3 biological replicates and 3 technical replicates.

As for qRT-PCR, total RNA was extracted from the above tissues using a rapid universal plant RNA extraction kit (Huachiu Ocean Co., Ltd., Bei**g, China) and were reverse-transcribed into cDNA using a reverse transcription kit (TaKaRa Bio, Bei**g, China). Nine genes with different transcriptome expression trends were selected for qRT-PCR experiments. According to the coding region sequence of the gene, the primers of the gene were designed by Primer 5.0. The primer information was sent to Shenggong Bioengineering Co., Ltd. (Shanghai, China) for synthesis. The primer information is shown in Table S2.

The qRT-PCR experiments were performed using a fluorescent quantitative PCR instrument (Thermo Fisher Scientific, Waltham MA, USA). The qRT-PCR reaction solution was prepared according to the instructions for use by TB Green Premix Ex TaqII (TaKaRa Bio, Bei**g, China). The procedure was as follows: pre-denaturation at 95 °C for 20 s, denaturation at 95 °C for 5 s, and annealing at 60 °C for 20 s. The cycle was performed 40 times, and the melting curve stages were 95 °C for 15 s, 60 °C for 60 s, and 95 °C for 15 s for one cycle. The reaction system was as follows: TB Green Premix Ex TaqII (2×) 12.5 μL, PCR Primers (10 μmol/L) 1 μL, RT reaction solution (cDNA solution) 2 μL, and ddH₂O 8.5 μL. The total volume was 20 μL. The Ct value of ‘Feizixiao’ lychee bud was set as 1, and the relative expression was calculated using the 2^−△△Ct method. The expression levels of the ANR gene in 9 tissues and the organs of a lychee were analyzed. The Ct value of the pericarp at Z2 stage was set as 1, and the relative expression level was calculated using the 2^−△△Ct method. The expression of the selected 9 genes in different fruit pericarps of ZNX and FZX was analyzed.

2.7. Determination of Total Anthocyanins in the Pericarps of ‘Feizixiao’ and ‘Ziniangxi’ Lychee

The frozen pericarp of the FZX and ZNX lychee was used as the material. A total of 0.5 g liquid nitrogen powder of the pericarp was taken into the ice pre-cooled mortar, and an appropriate amount of methanol solution containing 1% of HCl was added to continue grinding into the homogenization. The homogenization liquid was transferred into the glass test tube and kept under dark light for 2 h, then filtered, and the volume was fixed at 25 mL. The absorbance at 600 nm and 530 nm was determined by the UV spectrophotometer (UV2450, Shimadzu, Japan). The anthocyanin content was calculated as follows: anthocyanin content (0.01ΔA/gFW) = 100 × (A530 − A600)/fresh weight of sample. The determination of proanthocyanidins in the pericarps of the FZX and ZNX lychee was performed by Entrust Maiwei Company (Wuhan, China). Each sample had 3 biological replicates and 3 technical replicates.

2.8. Cloning of LcANR(LITCHI029356.m1) Gene and Construction of LcANR-OE Vector

Total RNA was extracted from the pericarp of the FZX lychee using a rapid universal plant RNA extraction kit (Huachiu Ocean Co., Ltd., Bei**g, China) and reverse transcribed into cDNA using a reverse transcription kit (TaKaRa Bio, Bei**g, China). Nine genes with different transcriptome expression trends were selected for qRT-PCR experiments. According to the coding region sequence of the gene, the primers of the gene were designed by Primer 5.0. The primer information was sent to Shenggong Bioengineering Co., Ltd. (Shanghai, China) for synthesis (primer sequence: LcANR-CDS-F: ATGGCCAGCGAGTTCACCG LcANR-CDS-R: TCACTTAAGCAGCCCCCTAGT). The sequencing results were compared with the gene (http://www.sapindaceae.com/, accessed on 7 September 2023) sequence, and the sequence was consistent with the description of the target gene. The vector was constructed by the TA cloning (CV17-Zero Background pTOPO-Blunt Simple Cloning Kit, Aidlab, Bei**g, China) experiment. After the vector was transferred into E. coli, the bacterial solution was sent for sequencing to verify the cloning of the target gene.

The electrophoresis fragment of LcANR-CDS with a length of 1008 bp was cut off, and the target fragment was recovered by agarose gel DNA recovery kit (Huachiu Ocean, Bei**g, China). In the transgenic experiment, the name of the transgenic vector we used was pCAMBIA1300, and the promoter in the vector was 35 S. The PCR detection band size was about 1100 bp. The positive plaque was detected, and the shaking bacteria were picked up. Sanger sequencing was performed on the bacterial solution, and the sequencing was entrusted to Bioengineering (Shanghai, China) Co., Ltd. The sequencing primer eGFP-cx was used to test the sequence, and the sequencing results were consistent with the sequence of the target fragment, that is, the overexpression vector was successfully constructed. The primer information is shown in Table S3. Vector map and vector sequence are shown in Table S4.

2.9. Construction of ANR-RNAi Vector

Knockdown NtANR(XM_016589997.1) in tobacco, which is the homologous gene most similar to the lychee LcANR(LITCHI029356.m1) sequence, further indicates that the similarity of gene structure will lead to the same function, which proves the function of LcANR. The homologous gene sequence of LcANR(LITCHI029356.m1) in tobacco was found using a database (http://www.sapindaceae.com/, accessed on 10 September 2023), and the homologous gene with high homology of LcANR in lychee was found for sequence alignment. The homologous genes of tobacco and the genes with a high similarity to the LcANR sequence were compared in NCBI to exclude interference with other genes. The results were compared and analyzed, and the NtANR(XM_016589997.1) gene in tobacco was the most similar to the LcANR(LITCHI029356.m1) sequence to design specific interference fragments. In the transgenic experiment, the name of the transgenic vector we used was pCAMBIA1300, and the promoter in the vector was 35 S. The target fragment was amplified by PCR to obtain the fragment ligation vector. The 288 bp electrophoresis fragment (ATATTTTTGTTGCTGAGAAAGAATCAGCTTCCGGACGATACATTTGTTCTGCCATCAACACCAGTGTTCCGGAGCTAGCAAATTTCTTGAAGAAAAGATATCCAACTTCGGATGTTCCTACAGATTTCGGGGATTTCCCCTCCAAGGCCAAGTTGATCATCTCGTCAGAAAAGCTCATCAAAGAGGGATTCAATTTTAAGTATGGGATTGAAGAGATTTATGATCAATGTCTTGCTTGTTTTAAAGATAAGGGGTTACTAAAGAACTGAATAGTTCAGTTAATATTGT) was cut off and the target fragment was recovered using the agarose gel DNA recovery kit (Huachiu Ocean, Bei**g, China). The primers of Linker (+)/NOS-R were used for colony PCR detection, and a band of about 490 bp was obtained. The positive plaque was detected, and the single colony shaking bacteria were picked. The plasmid extracted from the above-mentioned positive plaque was entrusted to Shenggong Bioengineering (Shanghai, China) Co., Ltd., and the sequencing primer Linker (+)/Linker (−) was used for bidirectional tests. The sequencing result sequence was consistent with the target fragment sequence alignment, that is, the overexpression vector was successfully constructed. The primer information is shown in Table S5. The vector map and vector sequence are shown in Table S6.

2.10. Genetic Transformation of LcANR Gene in Tobacco

The method of transferring LcANR(LITCHI029356.m1)into tobacco mainly refers to the method of transferring an apple gene into tobacco by HAN [48]. Tobacco K326 seeds were sterilized and sowed on MS or 1/2 MS medium, and the leaves at the 3–4 leaf stage were grown to obtain sterile leaves as explants. The explants prepared by resuscitating the bacteria for 1–2 h with the Agrobacterium suspension containing the constructed vector were placed in the Agrobacterium suspension. After 10 min of infection, the Agrobacterium liquid on the surface of the explants was dried with sterile filter paper. The dried tobacco explants were placed in co-culture medium at 25 °C for 2 days in the dark. The differentiation and screening of tobacco genetic transformation seedlings were carried out at the same time, and the differentiation time was 30–40 d. A DNA extraction kit (Huachiu Ocean Co., Ltd., Bei**g, China) was used to extract DNA from tobacco leaves, and a conventional PCR amplification was used to detect whether tobacco seedlings contained the hygromycin gene, which verified that LcANR(LITCHI029356.m1) was successfully transformed into tobacco. The primers for the hygromycin gene detection were as follows: (H (+): GCCAACCCGGCCTCCAGAAGA; H (−): CCGCAAGGAAATCGGTCAATACA). The band size of the positive material in the test results was 307 bp.

3. Results

3.1. Phylogeny of LcANR Sequences

Phylogenetic relationships were inferred for the lychee ANR peptide sequences, which showed that LcANR can be divided into seven subgroups, namely subgroups Ⅰ, Ⅱ, Ⅲ, Ⅳ, Ⅴ, Ⅵ, and Ⅶ. Subgroup Ⅰ was the largest, containing 30 LcANR family members, while subgroups Ⅱ and Ⅵ had 4 and 7 family members, respectively. Subgroup Ⅳ and subgroup Ⅶ had 3 LcANR family members. Subgroups Ⅲ and Ⅴ had 2 LcANR family members, respectively (Figure 2).

A phylogenetic tree of the ANR family of lychee, tea plant, apple, grape, and Arabidopsis was reconstructed using 38 ANR family protein sequences of Arabidopsis, together with 83 tea tree, 68 apple, 57 grape, and 51 lychee ones. In this tree, the branch of Arabidopsis ANR gene AT1G61720, which had been reported [24,25], was extracted to further determine the function of the LcANR gene in Lychee. LITCHI029356.m1 was found to be in the same branch as that of the Arabidopsis ANR gene, and the relative expression results obtained by high-throughput sequencing data and q-PCR were consistent with the anthocyanin content measured in lychee pericarp (F). These results indicated that LITCHI029356.m1 might function as anthocyanidin reductase in lychee.

3.2. Identification and Sequence Characterization of Lychee ANR Family Members

In this study, to identify LcANR family genes in lychee, the gene sequences of the Arabidopsis ANR family were used to perform the genome-wide PFAM and HMME search using the lychee database. A total of 51 ANR family members were identified in the lychee genome. The amino acid sequence length, molecular weight, isoelectric point, and subcellular localization of the identified genes were predicted and analyzed. The results are shown in Table S1. The length of the ANR protein is between 87 and 289 amino acids, and the molecular weight is between 9.49 and 32.40 KD. The isoelectric points (pI) of the 40 family members were all below 7, indicating that most of the Lc ANR proteins were acidic proteins. Prediction analysis showed that 40 members were located in the cytoplasm, 8 in the periplasm, and the remaining members were located in the outer membrane of the cell membrane, indicating that the lychee ANR family mainly functions in the cytoplasm.

3.3. ANR Motifs and Gene Structure

By analyzing the gene structure and motif of LcANR family members, it was found that the number of exons among LcANR family members was quite different. The motif analysis showed that the motifs of each member, composed of 1–9 motifs, were also quite different. Among them, motifs 1, 2, 3, 4, 5, and 7 appeared most in the lychee ANR family. Motif 1 appeared the most in the N-terminus, and motif 5 appeared the most in the C-terminus. Most of the genes have a similar motif structure. According to the similarity of motif distribution, lychee ANR members can be divided into 6 sub-branches (Figure 2a,b).

The results of the motif atlas showed that motif 5 contained the most conserved residues, which were composed of 17 amino acid sites. The 6th position in motif 5 is a conserved amino acid site, corresponding to aspartic acid residue (Figure 3c).

3.4. Chromosome Distribution, Tandem Gene Duplication, and Segmental Gene Duplication of ANR Genes in Lychee

The LcANR family members are distributed on 11 chromosomes and are unevenly distributed, namely Chr1, Chr3, Chr4, Chr5, Chr6, Chr8, Chr9, Chr10, Chr12, Chr13, and Chr14. Most members are located on Chr8. There are 12 family members on Chr8. There are eight family members on Chr13. In contrast, only one member is located on Chr4 (Figure 4).

To further understand the expansion of the LcANR gene family, we also analyzed segmental-duplicated gene pairs. Three segmental-duplicated gene pairs with six LcANR genes were also identified on lychee chromosomes (LITCHI014912.m1&LITCHI003640.m1, LITCHI022853.m1&LITCHI025537.m1, LITCHI013339.m1&LITCHI029352.m1) (Figure 5).

3.5. Cis-Acting Elements of ANR Family Members in Lychee

To understand the promoter sequence function of LcANR family members, we analyzed DNA sequences 2000 bp at the upstream of ORF (open reading frame) sequence of 51 LcANR family members (Figure 6). The cis-acting elements of the LcANRs promoters were predicted using the PlantCARE online tool [47]. The results showed that only the gene LITCHI009876.m3 had TATA-box and CAAT-box, and the other 50 family genes had TATA-box and CAAT-box.

Over 90% of the ANR members contain anaerobic-induced response elements, indicating that lychee ANR family members may play an important role in the redox process [49]. Over 88% of the members contain photoresponsivity elements, indicating that the gene expression of LcANR family may be regulated by light. Roughly 80% of the family members participate in abscisic acid reaction; 24 members participate in drought induction and 47% participate in salicylic acid reaction, suggesting that the ANR family members play an important role in resistance to adverse environment in lychee (

Table 1. Top 10 cis-acting elements in the ANR promoters in lychee.

No.	Motif Name	Genes Contained	Major Function
1	CAAT-box	50	Promoters and enhancers
2	TATA-box	50	Core promoter element
3	ARE	46	Essential for anaerobic induction
4	Box 4	45	Involved in light response
5	G-box	45	Participate in light reactions
6	ABRE	41	Involved in abscisic acid reaction
7	TCT-motif	29	Light responsive element
8	GT1-motif	28	Light responsive element
9	MBS	24	MYB binding site involved in drought-inducibility
10	TCA-element	20	Involved in salicylic acid responsiveness

).

3.6. Expression Analysis of ANR Family Members in Lychee

The expression of 51 LcANR family members was analyzed in nine tissues and organs, i.e., white root of air-layering seedlings, young leaf, bud, female flower, male flower, pericarp, pulp, seed, and embryonic calli. The results showed that the expression patterns of 51 genes were divided into four types. The first was with no expression, that is, the FPKM value was 0. The second showed low expression with the FPKM value ranged between 0 and 50. The third was moderate expression pattern with the FPKM value ranged from 50 to 200, and the fourth was high expression with the FPKM value over 200. A total of 5 genes had no gene expression, 25 had low gene expression, 11 had moderate gene expression, and 11 had high gene expression in different tissues. Among them, the LITCHI029356.m1 gene was highly expressed in buds, stamens, and pistils (Figure 7a).

RT-qPCR was used to analyze the relative expression levels of nine members of the LcANR family in different tissues and organs. The results were similar to those of transcriptome analysis. For example, in the results of RT-qPCR analysis, the expression level of LITCHI015992.m1 in the root was also highly expressed. The expression level of LITCHI019935.m1 in the transcriptome data was the highest in leaves, followed by peel and bud, and the same results were obtained in RT-qPCR analysis (Figure 7b).

3.7. Expression Analysis of LcANR Family Members in Lychee Pericarps

The expression of LcANR family members in lychee pericarps of two lychee varieties, FZX and ZNX, was investigated. According to the classification described in Section 3.7, 6 genes were not expressed, 31 had low expression, 6 had medium expression, and 8 had high expression in the fruit pericarp at different stages. The expression levels of the LITCHI029356.m1 gene were high in pericarps of both FZX and ZNX, and the expression level gradually decreases with the coloring of the pericarp in both varieties (Figure 8a).

The relative expression level of nine members of the lychee ANR family in different tissues and organs was confirmed with RT-qPCR, which showed that the results were similar to those of transcriptome analysis, demonstrating the reliability of the transcriptome data (Figure 8b).

3.8. Relationship between LITCHI029356.m1 Expression and Anthocyanin Accumulation in Fruit Pericarps

The expression of LITCHI029356.m1 gene in the pericarp of FZX and ZNX varieties at different fruit ages was further studied. When the ZNX fruits began to color (Z8-Z12), the gene expression decreased sharply; however, there was no significant decrease in the fruit coloration stage of FZX(F5-F9). The content of total anthocyanin in the pericarp of the two varieties at each fruit age showed that the content of total anthocyanin in the pericarp of the ZNX lychee was much higher than that of the FZX lychee at maturity, when it showed a sudden increase (Figure 9).

The gene expression data, combined with the changes of anthocyanin content in pericarp during fruit development, showed that anthocyanins in the pericarp of the two varieties gradually accumulated with the decrease in LITCHI029356.m1 expression in pericarp. This indicates that LITCHI029356.m1 in lychee plays a negative regulatory role in the accumulation of anthocyanin in the pericarp of ZNX and FZX lychee. At the same time, the difference in the expression of LITCHI029356.m1 in the two lychee varieties also affected the difference of seed coloring in pericarps of the two varieties. The LITCHI029356.m1 content in the early development of the ZNX lychee was much higher than that in the FZX lychee at the same period, and the expression of LITCHI029356.m1 in the mature ZNX late development was significantly decreased, and anthocyanin accumulation was significantly increased. The expression level of LITCHI029356.m1 in FZX ripening fruit was not significantly decreased, and the content of anthocyanin in ‘Feizixiao’ ripening fruit was much lower than that in ZNX ripening fruit (Figure 9).

Through the determination of proanthocyanidins in the peel and the correlation analysis between proanthocyanidins and LcANR(LITCHI029356.m1) gene, we found that the expression level of LcANR(LITCHI029356.m1) gene was significantly correlated with the content of proanthocyanidin A2, proanthocyanidin B1, proanthocyanidin B2, and proanthocyanidin B4 in the five proanthocyanidins detected in the peel (r > 0.7). These results indicate that LcANR(LITCHI029356.m1) is the dominant gene regulating the generation of these proanthocyanins. With the regulation of LcANR(LITCHI029356.m1), the generation of colorless anthocyanins will lead to a decrease in anthocyanin production, further indicating that the expression of LcANR(LITCHI029356.m1) plays a negative regulatory role in anthocyanin production (Figure 10).

3.9. Heterologous Expression of LcANR(LITCHI029356.m1) in Tobacco

To explore the role of the lychee ANR gene LITCHI029356.m1 as a potential negative regulator of pigmentation, we overexpressed this gene heterologously in tobacco variety K326, a red-petal cultivar with anthocyanin accumulated in petals. The results showed that the tobacco petal color turned lighter with the expression of LcANR(LITCHI029356.m1) in tobacco (Figure 10), suggesting down-regulation of anthocyanin accumulation in tobacco flowers with the heterologous expression of LcANR(LITCHI029356.m1). Furthermore, we suppressed the expression of the orthologous gene in tobacco with RNAi, and the results showed darker petals of the transgenic tobacco plants (Figure 11), indicating that suppression of the gene expression facilitated the accumulation of anthocyanin in tobacco petals. These results accumulatively confirmed the function of LcANR(LITCHI029356.m1) in negative regulation of anthocyanin biosynthesis in plants.

4. Discussion

Anthocyanins and proanthocyanidins are both types of flavonoids, commonly acting as antioxidants in plants. We started our study with the gene identification enabled by the lychee reference genome. As a result, 51 anthocyanidin reductase genes were identified in the lychee genome. The function of the anthocyanidin reductase group was preliminarily predicted through the sequence and phylogenetic analysis of gene family members, and the expression patterns of the family members in different tissues and varieties were analyzed using transcriptome sequencing and RT-qPCR. The expression patterns of lychee ANR gene family members vary among tissues, and many low-expression and zero-expression members were identified. For example, LITCHI011046.m1, LITCHI009870.m1, LITCHI011049.m1, ITCHI004431.m1, and LITCHI022853.m1 were not expressed in some tissues. The subcellular targeting results of the ANR gene family in lychees is different from the reported ANR gene family results in other species, such as tea plant. ANR members in tea tree are located in a variety of organelles [28], but ANR members in lychee are mostly located in the cytoplasm.

Anthocyanin and proanthocyanidin synthesis share the same substrate and convert to each other, so they compete with each other in the flavonoid metabolic network. Therefore, the study of anthocyanin reductase is very meaningful for the study of lychee pericarp coloring. In this paper, the anthocyanin reductase gene family of lychee was comprehensively identified, and its sequence, phylogeny, and expression characteristics were studied in depth. On the basis of evolutionary and expression analyses, LcANR(LITCHI029356.m1), which is an ANR family member, was identified. LcANR(LITCHI029356.m1) potentially encodes an enzyme synthesizing proanthocyanidin and acts as a key player in the competition with the anthocyanin accumulation in lychee pericarps. Our work lays the groundwork for the exploration of the lychee ANR family, paving the way for an in-depth understanding of the genetic underpinnings that govern the biosynthesis of both anthocyanins and proanthocyanidins.

To investigate the role of the ANR genes in lychee (pro)anthocyanin biosynthesis, two varieties with different modes of anthocyanin accumulation were used, and their expression patterns in different developmental stages were characterized through both transcriptome and RT-qPCR. The results show that LITCHI029356.m1 might play a key role in proanthocyanin biosynthesis. The functioning of this gene seems to lead to competition with anthocyanin accumulation, hence regulating lychee fruit skin coloring. Moreover, we found the transgenic tobacco experiments were consistent with negative regulation of pigmentation via the particular lychee ANR gene LITCHI029356.m1, probably via anthocyanin biosynthesis. This gene can be used as a potential target for breeding and genetic engineering to customize the pigment composition and distribution in lychee skin to enhance its visual attractiveness.

5. Conclusions

In summary, we identified many, possibly all, ANR gene family members in the L. sinensis genome and investigated their sequence, phylogeny, and expression characteristics in lychee, leading to the identification of a gene potentially acting as a key player in proanthocyanin biosynthesis in lychee. The function of the identified LcANR gene was confirmed by both heterologous expression and RNAi. Our work thus serves as a valuable starting point for further exploration into the enzymatic pathways and genetic control mechanisms to regulate the flavonoid accumulation in lychee.