Predictive and Prognostic Significance of mRNA Expression and DNA Copies Aberrations of ERCC1, RRM1, TOP1, TOP2A, TUBB3, TYMS, and GSTP1 Genes in Patients with Breast Cancer
Abstract
:1. Introduction
2. Materials and Methods
Patients and Treatment
3. Results
4. Discussion
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Duffy, M.J.; Crown, J. A personalized approach to cancer treatment: How biomarkers can help. Clin. Chem. 2008, 54, 1770–1779. [Google Scholar] [CrossRef] [Green Version]
- Li, J.; Sun, P.; Chuang, T.; He, S.; Li, L.; Xue, G. Individualized chemotherapy guided by the expression of ERCC1, RRM1, TUBB3, TYMS and TOP2A genes versus classic chemotherapy in the treatment of breast cancer: A comparative effectiveness study. Oncol. Lett. 2020, 21, 1. [Google Scholar] [CrossRef]
- Abdel-Fatah, T.; Ali, R.; Sadiq, M.; Moseley, P.M.; Mesquita, K.A.; Ball, G.; Green, A.R.; Rakha, E.A.; Chan, S.Y.; Madhusudan, S. ERCC1 Is a Predictor of Anthracycline Resistance and Taxane Sensitivity in Early Stage or Locally Advanced Breast Cancers. Cancers 2019, 11, 1149. [Google Scholar] [CrossRef] [Green Version]
- Yang, S.J.; Wang, D.D.; Li, J.; Xu, H.Z.; Shen, H.Y.; Chen, X.; Zhou, S.Y.; Zhong, S.L.; Zhao, J.H.; Tang, J.H. Predictive role of GSTP1-containing exosomes in chemotherapy-resistant breast cancer. Gene 2017, 623, 5–14. [Google Scholar] [CrossRef]
- Zhang, J.; Wu, Y.; Hu, X.; Wang, B.; Wang, L.; Zhang, S.; Cao, J.; Wang, Z. GSTT1, GSTP1, and GSTM1 genetic variants are associated with survival in previously untreated metastatic breast cancer. Oncotarget 2017, 8, 105905. [Google Scholar] [CrossRef] [Green Version]
- Dorman, S.N.; Baranova, K.; Knoll, J.H.; Urquhart, B.L.; Mariani, G.; Carcangiu, M.L.; Rogan, P.K. Genomic signatures for paclitaxel and gemcitabine resistance in breast cancer derived by machine learning. Mol. Oncol. 2016, 10, 85–100. [Google Scholar] [CrossRef]
- Narvi, E.; Jaakkola, K.; Winsel, S.; Oetken-Lindholm, C.; Halonen, P.; Kallio, L.; Kallio, M. Altered TUBB3 expression contributes to the epothilone response of mitotic cells. Br. J. Cancer 2013, 108, 82–90. [Google Scholar] [CrossRef] [Green Version]
- O’Malley, F.; Chia, S.; Tu, D.; Shepherd, L.; Levine, M.; Huntsman, D.; Bramwell, V.; Andrulis, I.; Pritchard, K. Topoisomerase II alpha protein and responsiveness of breast cancer to adjuvant chemotherapy with CEF compared to CMF in the NCIC CTG randomized MA. 5 adjuvant trial. Breast Cancer Res. Treat. 2011, 128, 401. [Google Scholar] [CrossRef]
- Zhong, W.; Yang, Y.; Zhang, A.; Lin, W.; Liang, G.; Ling, Y.; Zhong, J.; Yong, J.; Liu, Z.; Tian, Z. Prognostic and predictive value of the combination of TOP2A and HER2 in node-negative tumors 2 cm or smaller (T1N0) breast cancer. Breast Cancer 2020, 27, 1147–1157. [Google Scholar] [CrossRef]
- Horlings, H.M.; Lai, C.; Nuyten, D.S.; Halfwerk, H.; Kristel, P.; van Beers, E.; Joosse, S.A.; Klijn, C.; Nederlof, P.M.; Reinders, M.J. Integration of DNA copy number alterations and prognostic gene expression signatures in breast cancer patients. Clin. Cancer Res. 2010, 16, 651–663. [Google Scholar] [CrossRef] [Green Version]
- Nami, B.; Wang, Z. Genetics and expression profile of the tubulin gene superfamily in breast cancer subtypes and its relation to taxane resistance. Cancers 2018, 10, 274. [Google Scholar] [CrossRef] [Green Version]
- Schwartz, G.F.; Hortobagyi, G.N. Proceedings of the Consensus Conference on Neoadjuvant Chemotherapy in Carcinoma of the Breast, April 26–28, 2003, Philadelphia, Pennsylvania. Breast J. 2004, 10, 273–294. [Google Scholar] [CrossRef]
- Pfaffl, M.W. A new mathematical model for relative quantification in real-time RT–PCR. Nucleic Acids Res. 2001, 29, e45. [Google Scholar] [CrossRef]
- Zhou, F.; Yu, Z.; Jiang, T.; Lv, H.; Yao, R.; Liang, J. Genetic polymorphisms of GSTP1 and XRCC1: Prediction of clinical outcome of platinum-based chemotherapy in advanced non-small cell lung cancer (NSCLC) patients. Age 2011, 60, 75. [Google Scholar] [CrossRef] [PubMed]
- Herrick, J.; Sclavi, B. Ribonucleotide reductase and the regulation of DNA replication: An old story and an ancient heritage. Mol. Microbiol. 2007, 63, 22–34. [Google Scholar] [CrossRef]
- Bepler, G.; Williams, C.; Schell, M.J.; Chen, W.; Zheng, Z.; Simon, G.; Gadgeel, S.; Zhao, X.; Schreiber, F.; Brahmer, J. Randomized International Phase III Trial of ERCC1 and RRM1 Expression–Based Chemotherapy Versus Gemcitabine/Carboplatin in Advanced Non–Small-Cell Lung Cancer. J. Clin. Oncol. 2013, 31, 2404–2412. [Google Scholar] [CrossRef] [Green Version]
- Jørgensen, C.L.; Ejlertsen, B.; Bjerre, K.D.; Balslev, E.; Nielsen, D.L.; Nielsen, K.V. Gene aberrations of RRM1 and RRM2B and outcome of advanced breast cancer after treatment with docetaxel with or without gemcitabine. BMC Cancer 2013, 13, 541. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kakimoto, M.; Uetake, H.; Osanai, T.; Shirota, Y.; Takagi, Y.; Takeshita, E.; Toriya, Y.; Danenberg, K.; Danenberg, P.V.; Sugihara, K. Thymidylate synthase and dihydropyrimidine dehydrogenase gene expression in breast cancer predicts 5-FU sensitivity by a histocultural drug sensitivity test. Cancer Lett. 2005, 223, 103–111. [Google Scholar] [CrossRef]
- Zhang, Q.; Sun, T.; Kang, P.; Qian, K.; Deng, B.; Zhou, J.; Wang, R.; Jiang, B.; Li, K.; Liu, F. Combined analysis of rearrangement of ALK, ROS1, somatic mutation of EGFR, KRAS, BRAF, PIK3CA, and mRNA expression of ERCC1, TYMS, RRM1, TUBB3, EGFR in patients with non-small cell lung cancer and their clinical significance. Cancer Chemother. Pharmacol. 2016, 77, 583–593. [Google Scholar] [CrossRef]
- Soong, R.; Shah, N.; Salto-Tellez, M.; Tai, B.; Soo, R.; Han, H.; Ng, S.; Tan, W.; Zeps, N.; Joseph, D. Prognostic significance of thymidylate synthase, dihydropyrimidine dehydrogenase and thymidine phosphorylase protein expression in colorectal cancer patients treated with or without 5-fluorouracil-based chemotherapy. Ann. Oncol. 2008, 19, 915–919. [Google Scholar] [CrossRef]
- Katsetos, C.D.; Herman, M.M.; Mörk, S.J. Class III β-tubulin in human development and cancer. Cell Motil. Cytoskelet. 2003, 55, 77–96. [Google Scholar] [CrossRef] [PubMed]
- Chen, X.; Wu, J.; Lu, H.; Huang, O.; Shen, K. Measuring β-tubulin III, Bcl-2, and ERCC1 improves pathological complete remission predictive accuracy in breast cancer. Cancer Sci. 2012, 103, 262–268. [Google Scholar] [CrossRef] [PubMed]
- Wang, Y.; Sparano, J.A.; Fineberg, S.; Stead, L.; Sunkara, J.; Horwitz, S.B.; McDaid, H.M. High expression of class III β-tubulin predicts good response to neoadjuvant taxane and doxorubicin/cyclophosphamide-based chemotherapy in estrogen receptor–negative breast cancer. Clin. Breast Cancer 2013, 13, 103–108. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Sève, P.; Dumontet, C. Is class III β-tubulin a predictive factor in patients receiving tubulin-binding agents? Lancet Oncol. 2008, 9, 168–175. [Google Scholar] [CrossRef]
- Moretti, E.; Desmedt, C.; Biagioni, C.; Regan, M.M.; Oakman, C.; Larsimont, D.; Galardi, F.; Piccart-Gebhart, M.; Sotiriou, C.; Rimm, D.L. TOP2A protein by quantitative immunofluorescence as a predictor of response to epirubicin in the neoadjuvant treatment of breast cancer. Future Oncol. 2013, 9, 1477–1487. [Google Scholar] [CrossRef]
- Zhao, J.; Zhang, H.; Lei, T.; Liu, J.; Zhang, S.; Wu, N.; Sun, B.; Wang, M. Drug resistance gene expression and chemotherapy sensitivity detection in Chinese women with different molecular subtypes of breast cancer. Cancer Biol. Med. 2020, 17, 1014. [Google Scholar] [CrossRef] [PubMed]
- Chen, J.-R.; Chien, H.-P.; Chen, K.-S.; Hwang, C.-C.; Chen, H.-Y.; Yeh, K.-Y.; Hsieh, T.-Y.; Chang, L.-C.; Hsu, Y.-C.; Lu, R.-J. Amplification of HER2 and TOP2A and deletion of TOP2A genes in a series of Taiwanese breast cancer. Medicine 2017, 96, e5582. [Google Scholar] [CrossRef]
- Arai, T.; Miyoshi, Y.; Kim, S.; Akazawa, K.; Maruyama, N.; Taguchi, T.; Tamaki, Y.; Noguchi, S. Association of GSTP1 expression with resistance to docetaxel and paclitaxel in human breast cancers. Eur. J. Surg. Oncol. 2008, 34, 734–738. [Google Scholar] [CrossRef]
- Schnekenburger, M.; Karius, T.; Diederich, M. Regulation of epigenetic traits of the glutathione S-transferase P1 gene: From detoxification toward cancer prevention and diagnosis. Front. Pharmacol. 2014, 5, 170. [Google Scholar] [CrossRef] [PubMed]
- Song, B.; Wang, L.; Zhang, Y.; Li, N.; Dai, H.; Xu, H.; Cai, H.; Yan, J. Combined detection of HER2, Ki67, and GSTP1 genes on the diagnosis and prognosis of breast cancer. Cancer Biother. Radiopharm. 2019, 34, 85–90. [Google Scholar] [CrossRef]
- Li, J.; Sun, P.; Huang, T.; He, S.; Li, L.; Xue, G. Extensive analysis of the molecular biomarkers excision repair cross complementing 1, ribonucleotide reductase M1, β-tubulin III, thymidylate synthetase, and topoisomerase IIα in breast cancer: Association with clinicopathological characteristics. Medicine 2021, 100, e25344. [Google Scholar] [CrossRef] [PubMed]
Clinical and Pathological Parameter | The Number of Patients, abs.n. (%) | |
---|---|---|
Age | ≤45 | 44 (45.4) |
>45 | 53 (54.6) | |
Menstrual status | Premenopause | 51 (52.6) |
Postmenopause | 46 (47.4) | |
Tumor size | T1 | 15 (15.5) |
T2 | 71 (73.2) | |
T3 | 5 (5.2) | |
T4 | 6 (6.2) | |
Lymphogenous metastasis | N0 | 40 (41.2) |
N1 | 44 (45.4) | |
N2 | 6 (6.2) | |
N3 | 7 (7.2) | |
Histological form | Unicentric | 39 (40.2) |
Multicentric | 58 (59.8) | |
Histological type | Invasive ductal carcinoma | 54 (55.7) |
Invasive lobular carcinoma | 43 (44.3) | |
NAC regimen | CAX | 19 (19.6) |
AC | 30 (30.9) | |
Taxotere in mono | 21 (21.6) | |
AT/ACT | 16 (16.5) | |
CP | 11 (11.3) | |
NAC effect | Complete regression | 11 (11.3) |
Partial regression | 58 (59.8) | |
Stabilization | 25 (25.8) | |
Progression | 3 (3.1) |
Gene | Amplicon (bp) | Sequence |
---|---|---|
GAPDH | 124 bp | F 5′-gccagccgagccacatc-3′ |
R 5′-ggcaacaatatccactttaccaga-3′ | ||
Probe 5′-cgcccaatacgaccaaatccg-3′ | ||
RRM1 | 94 bp | F 5′-actaagcaccctgactatgctatcc-3′ |
R 5′-cttccatcacatcactgaacacttt-3′ | ||
Probe 5′-cagccaggatcgctgtctctaacttgca-3′ | ||
ERCC1 | 121 bp | F 5′-ggcgacgtaattcccgacta-3′ |
R 5′-agttcttccccaggctctgc-3′ | ||
Probe 5′-accacaacctgcacccagactacatcca-3′ | ||
TOP1 | 97 bp | F 5′-ggcgagtgaatctaaggataatgaa -3′ |
R 5′- tggatatcttaaagggtacagcgaa -3′ | ||
Probe 5′-accattttcccatcatcctttgttctgagc -3′ | ||
TOP2α | 75 bp | F 5′-agtcgctttcagggttcttgag-3′ |
R 5′-tttcatttacaggctgcaatgg-3′ | ||
Probe 5′-cccttcacgaccgtcaccatgga-3′ | ||
TUBB3 | 71 bp | F 5′-gggccaagttctgggaagtc-3′ |
R 5′-cgagtcgcccacgtagttg-3′ | ||
Probe 5′-atgagcatggcatcgaccccagc-3′ | ||
TYMS | 91 bp | F 5′-tctggaagggtgttttgga-3′ |
R 5′-tcccagattttcactccctt-3′ | ||
Probe 5′-tctttagcatttgtggatcccttga-3′ | ||
GSTP1 | 84 bp | F 5′-ctggtggacatggtgaatgac-3′ |
R 5′-cttgcccgcctcatagttg-3′ | ||
Probe 5′-aggacctccgctgcaaatacatctc-3′ |
Genes | CNA | General Group | CAX | AC | Taxotere in Mono | ACT/AT | CP | ||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|
CR + PR | P + ST | CR + PR | P + ST | CR + PR | P + ST | CR + PR | P + ST | CR + PR | P + ST | CR + PR | P + ST | ||
RRM1 | Loss | 24 (34.8) | 3 (10.7) | 6 (50.0) | 0 (0.0) | 9 (45.0) | 1 (10.0) | 3 (18.8) | 1 (20.0) | 4 (30.8) | 0 (0.0) | 2 (25.0) | 1 (33.3) |
n | 42 (60.9) | 22 (78.6) | 6 (50.0) | 6 (85.7) | 10 (50.0) | 8 (80.0) | 13 (81.3) | 4 (80.0) | 8 (61.5) | 2 (66.7) | 5 (62.5) | 2 (66.7) | |
Gain | 3 (4.3) | 3 (10.7) | 0 (0.0) | 1 (14.3) | 1 (5.0) | 1 (10.0) | 0 (0.0) | 0 (0.0) | 1 (7.7) | 1 (33.3) | 1 (12.5) | 0 (0.0) | |
p-level | 0.04 | 0.04 | 0.15 | 1 | 0.32 | 0.80 | |||||||
ERCC1 | Loss | 6 (8.7) | 4 (14.3) | 3 (25.0) | 1 (14.3) | 1 (5.0) | 1 (10.0) | 1 (6.3) | 0 (0.0) | 0 (0.0) | 0 (0.0 | 1 (12.5) | 2 (66.7) |
n | 60 (87.0) | 23 (82.1) | 9 (75.0) | 6 (85.7) | 18 (90.0) | 9 (90.0) | 15 (93.8) | 4 (80.0) | 11 (84.6) | 3 (100.0) | 7 (87.5) | 1 (33.3) | |
Gain | 3 (4.3) | 1 (3.6) | 0 (0.0) | 0 (0.0) | 1 (5.0) | 0 (0.0) | 0 (0.0) | 1 (20.0) | 2 (15.4) | 0 (0.0) | 0 (0.0) | 0 (0.0) | |
p-level | 0.70 | 0.85 | 0.68 | 0.16 | 1 | 0.15 | |||||||
TOP1 | Loss | 3 (4.3) | 0 (0.0) | 3 (25.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) |
n | 42 (60.9) | 23 (82.1) | 3 (25.0) | 6 (85.7) | 10 (50.0) | 8 (80.0) | 14 (87.5) | 5 (100.0) | 8 (61.5) | 2 (66.7) | 7 (87.5) | 2 (66.7) | |
Gain | 24 (34.8) | 5 (17.9) | 6 (50.0) | 1 (14.3) | 10 (50.0) | 2 (20.0) | 2 (12.5) | 0 (0.0) | 5 (38.5) | 1 (33.3) | 1 (12.5) | 1 (33.3) | |
p-level | 0.10 | 0.03 | 0.28 | 1 | 1 | 0.99 | |||||||
TOP2a | Loss | 14 (20.3) | 8 (28.6) | 3 (25.0) | 1 (14.3) | 3 (15.0) | 3 (30.0) | 3 (18.8) | 2 (40.0) | 0 (0.0) | 0 (0.0) | 5 (62.5) | 2 (66.7) |
n | 38 (55.1) | 15 (53.6) | 4 (33.3) | 5 (71.4) | 11 (55.0) | 4 (40.0) | 11 (68.8) | 3 (60.0) | 9 (69.2) | 2 (66.7) | 3 (37.5) | 1 (33.3) | |
Gain | 17 (24.6) | 5 (17.9) | 5 (41.7) | 1 (14.3) | 6 (30.0) | 3 (30.0) | 2 (12.5) | 0 (0.0) | 4 (30.8) | 1 (33.3) | 0 (0.0) | 0 (0.0) | |
p-level | 0.60 | 0.26 | 0.59 | 0.49 | 1 | 1 | |||||||
TYMS | Loss | 21 (30.4) | 4 (14.3) | 6 (50.0) | 0 (0.0) | 7 (35.0) | 2 (20.0) | 4 (25.0) | 0 (0.0) | 3 (23.1) | 0 (0.0) | 1 (12.5) | 2 (66.7) |
n | 45 (65.2) | 21 (75.0) | 5 (41.7) | 6 (85.7) | 13 (65.0) | 7 (70.0) | 12 (75.0) | 4 (80.0) | 8 (61.5) | 3 (100.0) | 7 (87.5) | 1 (33.3) | |
Gain | 3 (4.3) | 3 (10.7) | 1 (8.3) | 1 (14.3) | 0 (0.0) | 1 (10.0) | 0 (0.0) | 1 (20.0) | 2 (15.4) | 0 (0.0) | 0 (0.0) | 0 (0.0) | |
p-level | 0.16 | 0.07 | 0.28 | 0.10 | 0.43 | 0.15 | |||||||
TUBB3 | Loss | 41 (59.4) | 4 (22.2) | 5 (41.7) | 3 (42.9) | 10 (50.0) | 6 (60.0) | 13 (81.3) | 4 (80.0) | 10 (76.9) | 1 (33.3) | 3 (37.5) | 0 (0.0) |
n | 25 (36.2) | 13 (72.2) | 5 (41.7) | 4 (57.1) | 10 (50.0) | 4 (40.0) | 3 (18.8) | 1 (20.0) | 1 (7.7) | 1 (33.3) | 4 (50.0) | 3 (100.0) | |
Gain | 3 (4.3) | 1 (5.6) | 2 (16.7) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 2 (15.4) | 1 (33.4) | 1 (12.5) | 0 (0.0) | |
p-level | 0.01 | 0.49 | 0.87 | 1 | 0.30 | 0.30 | |||||||
GSTP1 | Loss | 7 (10.1) | 4 (14.3) | 3 (25.0) | 2 (28.6) | 2 (10.0) | 1 (10.0) | 0 (0.0) | 1 (20.0) | 2 (15.4) | 0 (0.0) | 0 (0.0) | 0 (0.0) |
n | 46 (66.7) | 20 (71.4) | 5 (41.7) | 5 (71.4) | 15 (75.0) | 7 (70.0) | 12 (75.0) | 4 (80.0) | 7 (53.8) | 2 (66.7) | 7 (87.5) | 2 (66.7) | |
Gain | 16 (23.2) | 4 (14.3) | 4 (33.3) | 0 (0.0) | 3 (15.0) | 2 (20.0) | 4 (25.0) | 0 (0.0) | 4 (30.8) | 1 (33.3) | 1 (12.5) | 1 (33.3) | |
p-level | 0.56 | 0.21 | 0.94 | 0.10 | 0.76 | 0.99 |
Factor | MFS | |
---|---|---|
HR (95% CI) | p-Value | |
Clinical and pathological parameter | ||
Age | ||
≤45 | 1.00 | |
>45 | 2.23 (0.46–10.84) | 0.32 |
Tumor size | ||
T1–2 | 1.00 | |
T3–4 | 4.45 (1.91–10.34) | 0.24 |
Lymphogenous metastasis | ||
N0 | 1.00 | |
N1 | 0.93 (0.22–3.95) | 0.92 |
N2 | 7.20 (0.91–56.74) | 0.06 |
N3 | 6.57 (0.90–48.16) | 0.06 |
Menstrual status | ||
Premenopause | 1.00 | |
Postmenopause | 0.61 (0.13–2.78) | 0.52 |
Histological type | ||
Invasive ductal carcinoma | 1.00 | |
Invasive lobular carcinoma | 0.83 (0.20–3.41) | 0.79 |
Histological form | ||
Unicentric | 1.00 | |
Multicentric | 3.07 (0.62–15.15) | 0.17 |
NAC effect | ||
Complete/Partial regression | 1.00 | |
Stabilization/Progression | 2.16 (0.61–7.69) | 0.23 |
Copy number aberrations | ||
RRM1 | ||
n | 1.00 | |
Loss | 0.36 (0.06–2.34) | 0.29 |
Gain | 1.28 (0.09–17.44) | 0.85 |
ERCC1 | ||
n | 1.00 | |
Loss | 2.23 (0.26–18.96) | 0.46 |
Gain | 0.98 (0.06–16.34) | 0.99 |
TOP1 | ||
n | 1.00 | |
Loss | 0.40 (0.004–40.54) | 0.77 |
Gain | 1.46 (0.10–20.69) | 0.38 |
TOP2α | ||
n | 1.00 | |
Loss | 3.29 (0.59–18.52) | 0.18 |
Gain | 0.39 (0.05–2.81) | 0.35 |
TYMS | ||
n | 1.00 | |
Loss | 0.17 (0.02–1.03) | 0.05 |
Gain | 1.36 (0.09–18.92) | 0.82 |
TUBB3 | ||
n | 1.00 | |
Loss | 5.31 (0.99–28.36) | 0.05 |
Gain | 0.73 (0.03–17.72) | 0.84 |
GSTP1 | ||
n | 1.00 | |
Loss | 2.26 (0.93–5.45) | 0.69 |
Gain | 0.48 (0.11–2.08) | 0.04 |
Expression | ||
RRM1 | ||
Low expression | 1.00 | |
High expression | 1.18 (0.15–9.44) | 0.88 |
ERCC1 | ||
Low expression | 1.00 | |
High expression | 0.76 (0.17–3.44) | 0.72 |
TOP1 | ||
Low expression | 1.00 | |
High expression | 5.09 (0.46–55.83) | 0.18 |
TOP2α | ||
Low expression | 1.00 | |
High expression | 3.29 (1.15–9.41) | 0.02 |
TYMS | ||
Low expression | 1.00 | |
High expression | 1.21 (0.21–6.89) | 0.83 |
TUBB3 | ||
Low expression | 1.00 | |
High expression | 0.37 (0.08–1.76) | 0.21 |
GSTP1 | ||
Low expression | 1.00 | |
High expression | 0.09 (0.003–2.86) | 0.17 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Tsyganov, M.M.; Ibragimova, M.K.; Garbukov, E.Y.; Tsydenova, I.A.; Gaptulbarova, K.A.; Dolgasheva, D.S.; Zdereva, E.A.; Frolova, A.A.; Slonimskaya, E.M.; Litviakov, N.V. Predictive and Prognostic Significance of mRNA Expression and DNA Copies Aberrations of ERCC1, RRM1, TOP1, TOP2A, TUBB3, TYMS, and GSTP1 Genes in Patients with Breast Cancer. Diagnostics 2022, 12, 405. https://doi.org/10.3390/diagnostics12020405
Tsyganov MM, Ibragimova MK, Garbukov EY, Tsydenova IA, Gaptulbarova KA, Dolgasheva DS, Zdereva EA, Frolova AA, Slonimskaya EM, Litviakov NV. Predictive and Prognostic Significance of mRNA Expression and DNA Copies Aberrations of ERCC1, RRM1, TOP1, TOP2A, TUBB3, TYMS, and GSTP1 Genes in Patients with Breast Cancer. Diagnostics. 2022; 12(2):405. https://doi.org/10.3390/diagnostics12020405
Chicago/Turabian StyleTsyganov, Matvey M., Marina K. Ibragimova, Evgeniy Yu. Garbukov, Irina A. Tsydenova, Kseniya A. Gaptulbarova, Daria S. Dolgasheva, Ekaterina A. Zdereva, Anastasia A. Frolova, Elena M. Slonimskaya, and Nikolai V. Litviakov. 2022. "Predictive and Prognostic Significance of mRNA Expression and DNA Copies Aberrations of ERCC1, RRM1, TOP1, TOP2A, TUBB3, TYMS, and GSTP1 Genes in Patients with Breast Cancer" Diagnostics 12, no. 2: 405. https://doi.org/10.3390/diagnostics12020405