Next Article in Journal
Molecular Responses of the Eukaryotic Cell Line INT407 on the Internalized Campylobacter jejuni—The Other Side of the Coin
Previous Article in Journal
Anti-Leishmania major Properties of Nuphar lutea (Yellow Water Lily) Leaf Extracts and Purified 6,6′ Dihydroxythiobinupharidine (DTBN)
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Ixodiphagus hookeri (Hymenoptera: Encyrtidae) and Tick-Borne Pathogens in Ticks with Sympatric Occurrence (and Different Activities) in the Slovak Karst National Park (Slovakia), Central Europe

1
Laboratory of Molecular Ecology of Vectors, Institute of Parasitology, Slovak Academy of Sciences, Hlinkova 3, 040 01 Košice, Slovakia
2
Department of Epizootiology, Parasitology and Protection of One Health, University of Veterinary Medicine and Pharmacy in Košice, Komenského 73, 040 81 Košice, Slovakia
3
Institute of Zoology Slovak Academy of Sciences, Dúbravská cesta 9, 845 06 Bratislava, Slovakia
4
Centre for Infectious Disease Control, National Institute for Public Health and the Environment, Antonie van Leeuwenhoeklaan 9, 3721 MA Bilthoven, The Netherlands
5
Department of Medical Physiology, Faculty of Medicine, Pavol Jozef Šafárik University in Košice, Trieda SNP 1, 040 11 Košice, Slovakia
*
Author to whom correspondence should be addressed.
Pathogens 2024, 13(5), 385; https://doi.org/10.3390/pathogens13050385
Submission received: 30 January 2024 / Revised: 27 April 2024 / Accepted: 4 May 2024 / Published: 7 May 2024
(This article belongs to the Topic Ticks and Tick-Borne Pathogens)

Abstract

:
Ticks are involved in the transmission a plethora of pathogens. To effectively control ticks and mitigate the risks associated with tick-borne diseases, it is important to implement tick control measures. These may include the use of acaricides as well as the development and implementation of an alternative, environmentally friendly tick management program that include practices such as habitat modification or establishing biological control. Ixodiphagus hookeri Howard is a tick-specific parasitoid wasp that predates on several species of ixodid ticks and could contribute to the control of the tick population. This work aimed to detect the presence of parasitoid wasps in ticks (Ixodidae) using genetic approaches. Several tick species of the genera Ixodes, Haemaphysalis, and Dermacentor, with a sympatric occurrence in the Slovak Karst National Park in southeastern Slovakia, were screened for the presence of wasps of the genus Ixodiphagus. The DNA of the parasitoids was detected in four tick species from three genera. This work presents the first molecular detection of parasitoids in two Dermacentor tick species, as well as the first molecular identification of Ixodiphagus wasps in Ixodes ricinus and Haemaphysalis concinna ticks from the Karst area. In the given area, it was observed that I. ricinus and H. concinna ticks are hyper-parasitized by wasps. Moreover, it was observed that wasps here can parasitize several tick species, some of which are of less significance for human and animal health (as they transmit fewer pathogens).

1. Introduction

The epidemiological significance of tick genera and species can vary considerably. While some species transmit fewer microorganisms, other tick species have a broad transmission competence and significantly impair society’s economy and public health. The vector competence of individual tick species for pathogens appears to be related to its microbiome [1,2,3,4,5]. Ticks not only transmit harmful pathogens but also host several symbiotic bacteria. These interact with each other and might have beneficial, neutral, or detrimental effects on their hosts. Endosymbionts may be involved in the physiological processes of a tick host, such as survival, development, fitness, reproduction, nutritional adaptations, defense against environmental stress, and immunity [5].
For tick control, it is crucial to understand the diverse interactions between members of the microbiome. These can increase the risk of infection by promoting the transmission or multiplication of certain species of vector-borne pathogens or can lead to the elimination of pathogenic species in co-infections because of competitive exclusion [5,6,7,8,9]. The microbiota in ticks is unstable and changes over time, mainly due to differences in the compositions of the “environmental” taxa [5,10]. The composition of tick microbiota is linked to and influenced by the presence of certain species of tick-borne pathogens. Conversely, several non-pathogenic microorganisms may affect the epidemiology of vector-borne diseases [5]. However, limited information exists about these interactions in I. ricinus microbiota. Even less or no data are available regarding other species [11].
Currently, tick control primarily relies on acaricides, but due to resistance, toxicity, and potential environmental harm, many synthetic formulations are no longer used [12,13]. Instead, the use of botanically based substances such as plant extracts, essential oils, and biological agents as alternatives to chemical pesticides is desirable. Moreover, ticks have various natural enemies, including birds (e.g., oxpeckers of the family Buphagidae), entomopathogenic bacteria, protozoa, or fungi (such as the genera Metarhizium and Beauveria), entomopathogenic nematodes, and parasitic wasps, which could also be used as alternatives in the fight against ectoparasites [14,15,16].
Encyrtid wasps of the Ixodiphagus spp. (Encyrtidae, Hymenoptera) are known to parasitize a broad range of tick species (Ixodida) across the world [8,17,18]. The wasp’s life cycle is synchronized with the stage-specific activities of juvenile ticks in nature [19]. Multiple female wasps can parasitize a single tick host simultaneously after locating them probably by using the tick and/or vertebrate host’s odor cues [11,19,20,21]. In regions with a mild climate, where the tick hosts are unavailable during the winter, wasps primarily lay eggs inside the bodies of unfed tick nymphs and remain in diapause [22,23,24]. The blood’s circulation, following a blood meal of a tick on the host, induces the embryonic development of the wasps, and the diapause of the eggs is terminated [8,17]. After hatching, the wasp larvae feed on the tick’s tissue and vertebrate blood ingested by the ticks [25,26]. One to two months after oviposition, adult wasps exit the empty tick body through a single hole at the posterior end of the abdomen [8,19,27].
This study aimed to detect the presence of parasitoid wasps in ticks (Ixodidae) using genetic approaches. Several tick species of the genera Ixodes, Haemaphysalis, and Dermacentor, with a sympatric occurrence in the Slovak Karst National Park in southeastern Slovakia, were screened for the presence of wasps of the genus Ixodiphagus. Additionally, this study aimed to evaluate the range of tick-borne microorganisms that circulate in the natural foci. A comparison of the diversity of endosymbionts, pathogens, and parasites in ticks parasitized by wasps versus ticks without wasps could provide insights into the relationship between the microbes and the potential influence of the presence of parasitoids on tick-borne infections.

2. Material and Methods

2.1. Study Area

The study area is situated in the largest Karst plain in Central Europe, in the southwestern part of eastern Slovakia. It is a warm and moderately humid region with cold winters (January temperature < −3 °C). The mean number of summer days per year is >50 [28]. Diverse environmental conditions at the site determine the coexistence of several endemic species of animals and plants, which are typical of mountain, forest, or steppe landscapes. The collection site was established in the area situated on the northern grassy slope of the “Dolný vrch” hill, which is covered with scattered islands of xerophilous shrubs (212 m a.s.l., 48°34′53″ N, 20°46′44″ E), near Hrhov village (Slovak Karst National Park). It is a recreational area with a significant diversity of game animals (e.g., roe deer/Capreolus capreolus, red deer/Cervus elaphus, and wild boar/Sus scrofa). The location is mostly used for hunting purposes and as pastures for farm animals (mainly cattle). The sympatric occurrence of 7 tick species, namely I. ricinus, I. trianguliceps, I. frontalis, Dermacentor reticulatus, D. marginatus, Haemaphysalis inermis, and H. concinna, with an allochronic or asynchronous peak activity was recorded on the site.

2.2. Tick Sampling

Ticks were collected every month during the vegetation period from 2012 to 2022. The temperature and relative humidity of the environment were measured year round at the location using electronic devices (Reed R6030 with an accuracy of 1 °C and 1% RH). Flagging of the vegetation using a white cloth flag with a size of 1 × 1 m mounted on a wooden stick was implemented during tick collection [29]. The same methodological procedure was followed for each collection, which lasted for at least one hour. The tick collection was usually performed between 9:00 and 11:00 am. After every 1 to 2 m of flagging, the flag’s sides were checked for the presence of ticks. The ticks were collected, stored, and transported to the laboratory in 70% ethanol. In the laboratory, they were identified by the species and gender using a taxonomic key [30].
Tick specimens that were not used in this study were included in several previously published eco-epidemiological studies [31,32,33,34].
During these 10 years, each sampling year included approximately 30 adult ticks, 30 nymphs, and 10 pools of 10 I. ricinus larvae for molecular analyses. A total of 1603 I. ricinus ticks, which included 303 adults (154 males and 149 females), 300 nymphs, and 100 pools of 10 larvae each were analyzed.
In total, 1240 H. concinna (3 adult females, 297 nymphs, and 94 pools of 10 larvae each) ticks were tested.
Altogether, 124 H. inermis (60 females, 55 males, and 9 nymphs), 57 D. reticulatus (31 females, 19 males, and 7 nymphs), and 30 D. marginatus (12 males, 7 females, 8 nymphs, and 12 larvae) ticks collected from vegetation within the sampling period were analyzed.
Additionally, we analyzed 2 H. inermis larvae, which were removed from trapped Apodemus spp., 19 I. trianguliceps larvae from Apodemus spp., 95 larvae of D. marginatus from Apodemus spp. and Clethrionomys glareolus, as well as 72 D. reticulatus larvae from Apodemus spp., a Clethrionomys sp., and white-toothed shrew (Crocidura leucodon) to determine the presence of wasps and microbes. Rodent trap** methods are described in the works of Heglasová et al. [32,33] and were realized based on permission from the Ministry of Environment of the Slovak Republic, No. 4559/2015-2.3. The questing adult ticks and nymphs, as well as engorged juvenile ticks from small mammals, were processed separately, and the prevalence rates for wasps and microbes were calculated. For the pools of questing larvae, the minimum infection rate (MIR) was calculated as the ratio of the number of positive pools to the total number of larvae tested. The MIR assumes that only one infected individual exists in a positive pool [35].

2.3. DNA Extraction

Genomic DNA was extracted from the questing ticks using alkaline hydrolysis [36]. For the engorged ticks that were removed from the rodents captured at the model site for Heglasová et al.’s [32] study, the total DNA was extracted from each tick separately after an overnight incubation with a Proteinase K solution at 56 °C using the NucleoSpin Tissue kit (Macherey-Nagel, Düren, Germany), according to the manufacturer’s instructions.
All DNA samples were stored at −20 °C until further processing. The concentration of genomic DNA isolated from ticks was measured in a group of randomly chosen samples using a NanoPhotometer™ UV/Vis Spectrophotometer (Implen GmBH, Munich, Germany).

2.4. PCR Screening

Questing I. ricinus and H. concinna ticks and engorged ticks (Dermacentor spp., H. inermis, and I. trianguliceps) from rodents were examined using conventional PCR assays with genus-specific or species-specific primer pairs, according to published protocols (Table 1). Initially, all genomic DNA samples were screened for parasitoid wasps, Ixodiphagus (Iph.) hookeri, by amplifying fragments of the mitochondrial gene for cytochrome oxidase subunit 1 (cox1) and the ribosomal 28S rRNA gene. Subsequently, the DNA samples were examined for the presence of endosymbiotic bacteria of the Wolbachia spp., as well as pathogens or endosymbionts from the following genera: Borreliella, Anaplasma, Bartonella, Babesia and Rickettsia.
Questing Dermacentor spp. and H. inermis ticks from vegetation were examined for the presence of Iph. hookeri using a qPCR assay targeting the 104 bp fragment of cox1, according to Krawczyk et al. [37]. The presence of Borreliella spp./Borrelia spp. was detected using DNA duplex qPCR, which targets the flagellin gene, and the B. burgdorferi sensu lato-specific OspA gene encoding the outer surface protein A, according to de Leeuw et al. [38]. Subsequently, all qPCR-positive samples from OspA/flaB duplex qPCR were examined using conventional PCR to amplify the intergenic spacer region (IGS) of B. burgdorferi s.l., according to Coipan et al. [39], and sequenced. Three multiplex qPCR assays were used for the detection of Anaplasma spp., Babesia spp., Bartonella, and Rickettsia spp., as published by Azagi et al. [40].
Table 1. PCR primers and conditions used for molecular detection of pathogens in questing I. ricinus and H. concinna ticks and Dermacentor spp., H. inermis, and I. trianguliceps ticks removed from rodents, using conventional PCR assays.
Table 1. PCR primers and conditions used for molecular detection of pathogens in questing I. ricinus and H. concinna ticks and Dermacentor spp., H. inermis, and I. trianguliceps ticks removed from rodents, using conventional PCR assays.
PathogenTarget GeneLength (bp)Primer NamePrimer Sequence (5′–3′)PCR Annealing TemperatureReference
Bacteria
Anaplasma
phagocytophilum
msp2334MSP2fCCA GCG TTT AGC AAG ATA AGA G55 °C[41]
MSP2rGCC CAG TAA CAT CAT AAG C
Borreliella spp.rrfA-rrlB222–255IGSaCGA CCT TCT TCG CCT TAA AGC57 °C[42]
IGSbAGC TCT TAT TCG CTG ATG GTA
Bartonella spp.ssrA257ssrA-FGCT ATG GTA ATA AAT GGA CAA TGA AAT AA60 °C[43]
ssrA-RGCT TCT GTT GCC AGG TG
Rickettsia spp.gltA
nested
381RpCS.877p RpCS.1258nGGG GAC CTG CTC ACG GCG G
ATT GCA AAA AGT ACA GTG AAC C
58 °C[44]
338RpCS.896pGGC TAA TGA AGC AGT GAT AA
RpCS.1233nGCG ACG GTA TAC CCA TAG C
Wolbachia spp.wsp590–632wsp81FTGG TCC AAT AAG TGA TGA AGA AAC55 °C[8] modified
wsp691RAAA AAT TAA ACG CTA CTC CA
Piroplasms
Babesia/Theileria spp.18S rRNA433–489BJ1GTC TTG TAA TTG GAA TGA TGG58 °C[45]
BN2TAG TTT ATG GTT AGG ACT ACG
Hymenopterans28S rRNA 56028s-hym-FAGACCGATAGCGAACAAGTA59 °C[46]
28s-hym-RGGTCCTGAAAGTACCCAAA
Iph. hookeriCO1268401FTTTAGAATATTTATTGATTCAGGGACT53 °C[8]
44RCTCCTGCTAAAACTGGTAAAGATAAT
The selected positive PCR products, with amplified fragments of wasp- and/or pathogen-related genes, were purified using the NucleoSpin Gel and PCR Cleanup kit (Macherey-Nagel GmbH & Co., Duren, Germany) and Sanger sequenced in both directions using the corresponding PCR primers in the Laboratory of Biomedical Microbiology and Immunology (University of Veterinary Medicine and Pharmacy in Košice, Slovakia) and/or by Eurofins Genomics (Ebersberg, Germany).
Contiguous sequences were assembled and inspected for errors using MEGA 11 software [47]. The analyses of the assembled sequences were performed with BLASTn via GenBank. Nucleotide sequences were aligned using Clustal W and checked for the presence of polymorphisms within overlapped, analyzed gene fragments.

2.5. Statistical Analysis

Cross-tabulations were used to analyze the correlation between the presence of Iph. hookeri parasitoids and the presence of pathogens (Wolbachia, Borreliella, Anaplasma, Rickettsia, Babesia, and Bartonella) on I. ricinus, H. concinna, H. inermis, D. reticulatus, and D. marginatus ticks separately.
Pearson’s Chi-square, Maximum Likelihood Chi-square, Yates’ Correction of Chi-square, and Phi-square tests were used to test the measure of association. A p-value less than 0.001 determined a significant relation between variables (in the case of the first three Chi-square coefficients). The Phi-square value can range from 0 (no relation between factors) to 1 or −1 (perfect positive or negative relation between the two factors in the table). We reported Yates’ Correction of Chi-square (which is recommended for 2 × 2 tables) and Phi-square coefficients.
The analyses were conducted using StatSoft, Inc. (2013), STATISTICA (data analysis software system), version 12 (www.statsoft.com, accessed on 1 January 2021).

2.6. Calculation of Odds Ratio

The Odds ratio values were calculated using the calculators online available (https://select-statistics.co.uk, accessed on 1 January 2022) to determine the likelihood of pathogen accumulation in ticks that were infested by wasps (the co-occurrence of Iph. hookeri and tick-borne pathogens in various tick species).

3. Results

3.1. Molecular Identification of Iph. hookeri

To determine the presence and prevalence of endoparasitic wasps in an area with a sympatric occurrence of several epidemiologically important tick species, six out of seven species that are known to be present there were examined. The presence of endoparasitic wasps was recorded in questing juvenile I. ricinus and H. concinna ticks and in one D. reticulatus male from vegetation (Table 2 and Table 3). Moreover, partially engorged larvae of D. marginatus (n = 3) and D. reticulatus (n = 12) were removed from Apodemus spp. and Clethrionomys spp. trapped at the site and tested positive for Iph. hookeri (Table 4).

3.2. The Presence of Iph. hookeri and the Prevalence of Pathogens in Questing I. ricinus Ticks

Wasps were only found in I. ricinus nymphs, and all nymphs that were parasitized by a wasp carried DNA from Wolbachia spp. Tick-borne pathogens were detected in 46.43% (n = 280/603) of all examined I. ricinus ticks, with Borreliella spp. being the most prevalent, followed by Bartonella spp., Rickettsia spp., Anaplasma spp., and Babesia spp. Out of the 100 pools of examined larvae, 38 tested positive for tick-borne microorganisms. The most prevalent were Rickettsia spp., followed by an equal infection rate for Anaplasma spp. and Bartonella spp. Additionally, two pools of larvae tested positive for Babesia spp., but these could not be closely determined into species.
The spectrum of pathogens detected in the ticks infested by wasps was limited to the presence of three genera of bacteria, with the most prevalent being Bartonella spp., followed by Borreliella spp. and Rickettsia spp.
Ticks not infested by Iph. hookeri were found to carry a wider spectrum of pathogens compared to those parasitized by a wasp. The overall prevalence of pathogens in all I. ricinus ticks that were not infested by a wasp was highest for Borreliella spp., followed by Bartonella spp., Rickettsia spp., Anaplasma spp., and Babesia spp. (Table 2).
Babesia microti (PP086648 and PP086656) was identified in most of the females and nymphs of I. ricinus. Rickettsia helvetica (PP230811-PP230815) and Rickettsia sp. (PP230816) closely related to R. monacensis were detected in larvae, nymphs, and adult I. ricinus ticks. Regarding Bartonella spp., I. ricinus ticks carried DNA from B. bovis (PP230802-PP230805), as well as a Bartonella sp. closely related to B. grahamii (PP230809). All the samples were examined for the presence of B. miamotoyi, which was not confirmed in any of the tested samples. Several randomly chosen Borreliella sp.-positive samples were sequenced, predominantly representing B. garinii and B. afzelii (PP230799). All the samples that tested positive for Borreliella spp. in this study are referred to here as Lyme disease-causing borreliae of the sensu lato complex.

3.3. The Presence of Iph. Hookeri and the Prevalence of Pathogens in Questing H. concinna Ticks

Haemaphysalis concinna nymphs represented the stage of tick most infested by wasps, and all infested nymphs carried DNA from Wolbachia. Interestingly, two H. concinna females and a single nymph that tested negative for the presence of wasps were found to carry DNA from Wolbachia spp. In addition, two pools of larvae tested positive for Iph. Hoookeri.
Tick-borne pathogens were found in 13.67% (n = 41/300) of the examined H. concinna ticks, with Babesia spp. being the most prevalent pathogen, followed by Bartonella spp., Rickettsia spp., and Anaplasma spp. No Borreliella spp. were detected in any of the tested H. concinna ticks. Out of 94 pools of larvae tested, 6 carried DNA from tick-borne microorganisms, namely Rickettsia spp. and Babesia spp.
Only one H. concinna nymph that was parasitized by a wasp tested positive for Anaplasma spp., and one pool of larvae tested positive for Rickettsia spp.
Haemaphyslis concinna nymphs that were not infested by wasps carried the DNA of Babesia spp., Bartonella spp., and Rickettsia spp. Similarly, pools of larvae that were not infested by wasps carried DNA from Rickettsia spp. and Babesia spp. (Table 2).
The sequencing of positive amplicons confirmed the presence of R. helvetica (PP230818 and PP230819) and a Rickettsia sp. (P230817) closely related to the endosymbiont Cand. R. mendelei, Babesia canis (PP086528 and PP086530), a Babesia sp. closely related to Babesia sp. 2 (Eurasia) (PP086565), Theileria capreoli (PP086524, PP086526, PP086532, PP086645, PP086646, PP086675, and PP086676), and a Babesia sp. (PP213167) closely related to Babesia motasi.

3.4. The Presence of Iph. hookeri and the Prevalence of Pathogens in Questing and Engorged H. inermis Ticks

All the H. inermis ticks examined for the presence of parasitoids carried DNA from Iph. hookeri. At the same time, all the ticks tested negative for Wolbachia spp. However, the presence of Rickettsia spp., Anaplasma spp., and Bartonella spp. was recorded in this tick species.
Additionally, two larvae were removed from Apodemus and Clethrionomys spp. Although it tested negative for Iph. hookeri, one larva carried DNA from a Babesia sp. (Table 3) closely related to a strain previously isolated from H. concinna ticks, e.g., the Irkutsk region in Russia (KT725852).

3.5. The Presence of Iph. hookeri and the Prevalence of Pathogens in Questing and Engorged D. marginatus Ticks

Molecular screening for the presence of Iph. hookeri and Wolbachia spp. in this tick species was conducted, with negative results. These ticks were infected to a significant extent with SFG Rickettsia spp. Moreover, they carried DNA from Anaplasma spp., followed by Borreliella spp. and Bartonella spp., mainly represented by B. grahamii (PP230800 and PP230806-PP230808).
In addition to this, a total of 95 larvae were collected from wild rodents. Out of these, three larvae from small mammals tested positive for Iph. hookeri and Wolbachia spp. Additionally, one of these three larvae tested positive for Babesia spp. Among the engorged larvae, the highest prevalence was observed for Borreliella spp. and Rickettsia spp., followed by Bartonella spp. (Table 3).

3.6. The Presence of Iph. hookeri and the Prevalence of Pathogens in Questing and Engorged D. reticulatus Ticks

Among the 57 D. reticulatus ticks collected from vegetation, only one male tested positive for the presence of wasp DNA and Rickettsia spp. In wasp-free ticks from vegetation, the SFG Rickettsia spp. was the most prevalent microorganism followed by Anaplasma spp. Multiplex rt-PCR confirmed B. microti in a single specimen, while a Borreliella sp. and Bartonella spp. were not detected in any of the DNA samples.
In total, 16.67% of D. reticulatus larvae removed from wild rodents carried DNA from Iph. hookeri, and all but one tested positive for Wolbachia spp. The presence of Babesia spp., Borreliella spp., Rickettsia spp., and Bartonella spp. was confirmed in these engorged larvae.
The spectrum of pathogens detected in larvae from rodents infested by a wasp was narrower compared to ticks without wasps.
Ticks from rodents that were not affected by the presence of a wasp carried DNA from Rickettsia spp., Babesia spp., Borreliella spp., and Bartonella spp. (Table 4). The most prevalent species observed in the positive samples was closely related to B. grahamii (PP230810).

3.7. The Presence of Iph. hookeri and the Prevalence of Pathogens in Engorged I. trianguliceps Ticks

In total, 19 unfed or partially engorged I. trianguliceps larvae were removed from the small mammals of the genus Apodemus. All of them tested negative for Iph. hookeri, and all other microbes, except one partially engorged larva, tested positive for SFG Rickettsia spp.

3.8. Genetic Variation, Phylogenetic Analyses, and Nucleotide Sequences Obtained in the Study

All cox1 nucleotide sequences of Iph. hookeri with a length of ± 270 bp obtained from different tick species in this study were identical with each other and showed 100% (97% query coverage/QC) identity with an I. hookeri Gardouch isolate from I. ricinus collected in France (JQ315225), and 87.55% (98% QC) similarity with the Encyrtidae sp. isolate BIOUG04746-H09 (KY830571) from Pakistan. In cox1-positive samples, an additional genetic marker, a portion of ribosomal 28S rRNA, was analyzed [48]. Partial 28S rRNA nucleotide sequences of the hymenopterans obtained from I. ricinus and H. concinna nymphs from the study were identical to each other in the overlap** region. On the other hand, several polymorphisms were detected in the partial hymenopteran 28S rRNA sequence from the D. marginatus larva removed from Apodemus agrarius after its comparison with sequences from wasps from I. ricinus and H. concinna nymphs.
The similarity between Iph. hookeri 28S rRNA fragments from D. marginatus and homologous sequences from H. concinna and I. ricinus was 98.2% and 98.5%, respectively.
It was confirmed that the 28S rRNA nucleotide sequences obtained from I. ricinus and H. concinna in this study are identical to the isolate from I. ricinus (OQ316577) from northwestern Hungary, close to the borders of Austria and Slovakia. They are also identical to the GP15 genotype found in Rhipicephalus microplus, Ixodes persulcatus, Dermacentor silvarum, and H. concinna (MN956813) ticks collected in Western Africa and near the city of Khabarovsk in Far Eastern Russia. Furthermore, the analysis revealed that there is a 99.42% similarity with I. hookeri Ixo4 (MH077537) previously isolated in Slovakia from I. ricinus [48]. Nearly all ticks infested with wasps carried the DNA of Wolbachia pipientis.
The nucleotide sequences obtained in this study were deposited in the GenBank database under the following accession numbers: for Iph. hookeri cox1 (PP079105-PP079111); for Iph. hookeri 28S rRNA (PP084992-PP085022) (Table 5).

3.9. Molecular Detection of Microbes in Ticks

The column graphs in Figure 1. indicate that I. ricinus, D. reticulatus, and D. marginatus ticks carried a wider spectrum of pathogens, with Borreliella, Rickettsia, and Bartonella (in I. ricinus) being the most detected. Babesia/Theileria spp. were predominantly found in H. concinna ticks, while Rickettsia spp. were most often detected in H. inermis ticks. The Ixodes trianguliceps ticks included in this study tested negative for all microbes, except for one specimen, which tested positive for Rickettsia spp.

3.10. Statistical Evaluation of the Correlations between the Presence/Absence of Wasps and Microbes in Screened Ticks

A significant association was confirmed between I. hookeri and Wolbachia spp. for all tick species included in this study (I. ricinus: Yates’ Correction of Chi-square = 637.5, df = 1, p ≤ 0.0001; Phi = 0.98; H. concinna: Yates’ Correction of Chi-square = 266.7, df = 1, p ≤ 0.0001; Phi = 0.57; D. reticulatus: Yates’ Correction of Chi-square = 96.7, df = 1, p ≤ 0.0001; Phi = 0.91; D. marginatus: Yates’ Correction of Chi-square = 85.9, df = 1, p ≤ 0.0001; Phi = 1.0).
This study found a significant correlation between I. hookeri and Bartonella spp. in I. ricinus (Yates’ Correction of Chi-square = 7.43, df = 1, p ≤ 0.0001; Phi = 0.12). In H. concinna, a correlation between I. hookeri and Anaplasma spp. was observed (Yates’ Correction of Chi-square = 3.66, df = 1, p ≤ 0.0001; Phi = 0.21). Similarly, a significant association between I. hookeri and Babesia spp. was confirmed in D. marginatus (Yates’ Correction of Chi-square = 9.75, df = 1, p ≤ 0.0001; Phi = 0.57)

3.11. Calculation of Odds Ratio

The findings show that in I. ricinus ticks, the presence of the Iph. hookeri wasp increased the probability of tick-borne pathogen accumulation by 2.11 times compared to ticks without the wasp. In D. reticulatus, the odds ratio of 1.46 indicated a higher likelihood of co-occurrence of wasps and pathogens. On the other hand, for D. marginatus and H. concinna, odds ratios of 0.92 and 0.66 suggested a decreased likelihood of co-occurrence, respectively (Table 6).
Six different species were tested for the presence of Iph. hookeri, Wolbachia spp., Borreliella spp., Anaplasma spp., Bartonella spp., and Rickettsia spp. In four species, the presence of Iph. hookeri was confirmed. Odds ratios >1 and <1 indicate the increased and decreased co-occurrences of wasps and pathogens, respectively.

4. Discussion

Studies have shown that Ixodiphagus spp. can potentially reduce tick populations, and as such, have been considered a promising candidate for tick control since their discovery in 1907 by Howard [17,49,50]. Most attempts to control ticks through parasitoid wasps were carried out about 100 years ago, with limited information about the biology of the wasps and their interactions with ticks [22,51,52]. Therefore, these attempts were not successful, most likely because the strains of parasitoid wasps from different geographic regions were not adapted to the local tick species, the seasonal pattern of occurrence, and the climatic conditions in which they were introduced (e.g., Iph. hookeri strains from Texas, USA released in South Africa, Italy, and Portugal) [53]. Among the more successful attempts to reduce tick populations using parasitoid wasps was the release of the local Iph. hookeri wasps on Naushon Island (USA) and in Kenya [54,55].
In Europe, Iph. hookeri has been confirmed in the Czech Republic [56], Ukraine [48], France [8,57], Georgia [58], Germany [19,59,60], the Netherlands [6,61], Finland [62], Italy [51], the United Kingdom [63], and Hungary [18]. In 1992, the parasitoid wasp Iph. hookeri was identified in three locations in Slovakia. It was found in the western part of the country and in the Slovak Karst region, in H. concinna and I. ricinus [27,31,64,65]. Our study brings the first molecular identification of Ixodiphagus wasps in I. ricinus and H. concinna ticks from Karst region and the first molecular detection of parasitoids in two Dermacentor species. The occurrence of various tick species with a nearly year-round activity and the wide range of hosts for tick development in this area creates a favorable environment for the wasps. Previously, ticks were collected here by Buczek et al. [31]. The authors reported a high percentage of I. ricinus (27.78%) and H. concinna (10.64%) nymphs infected with endoparasitic wasps. In our study, a lower prevalence of 7.0% and 7.74% for Iph. hookeri in I. ricinus and H. concinna were observed, respectively.
In western Slovakia, 13.8% of 50 examined I. ricinus nymphs were found to be infested by wasps [27]. In Lower Saxony, Germany, 1.86% to 3.8% of I. ricinus nymphs carried wasps, while in the Baden-Württemberg region, the rate of infestation was 2.41% to 3.24% [19]. In the southwest of the Netherlands, wasps were detected in 4% to 26% of I. ricinus nymphs, and in the northwest, the rate was 0.1% to 16% [37,61]. In the western part of France, 3.2% to 12.5% of I. ricinus ticks removed from roe deer and 19.6% to 20% of ticks from deer and vegetation in the southwest of the country tested positive for Iph. hookeri [8]. In Italy, 8.2% of I. ricinus ticks were found to be infected with a wasp [51], while in Finland, the rate of infestation was 0.4% to 2.3% in I. ricinus nymphs [62].
In Hungary, Tóth et al. [18] identified the southernmost detection point of Iph. hookeri in Central Europe. The authors found wasps in I. ricinus nymphs from 5 out of 21 screened sampling sites across the country. The authors compared 28S rRNA isolates from several sites in Hungary with an isolate (MH077537) obtained from Iph. hookeri-positive I. ricinus ticks from western Slovakia [46]. In our study, we found that the 28S rRNA sequences from I. ricinus and H. concinna from the Slovak Karst, which is close to several sampling sites in northern Hungary, where Iph. hookeri-infested ticks were not confirmed by Tóth et al. [18], are 100% identical with the isolate “Ihc” (OQ316577) from the western part of Hungary. This site borders Slovakia, where the Iph. hookeri 28S rRNA isolate Ixo4 (MH077537) was obtained by Gaye et al. [46]. In H. concinna and I. ricinus isolates from the Slovak Karst area, we identified at least three polymorphic sites previously described in Hungarian isolates, suggesting their genetic similarity.
The presence of Iph. hookeri was found to be positively correlated with the density of questing ticks and hosts, especially from the family Cervidae [37,54]. However, no correlation was found between the prevalence of Iph. hookeri in ticks and small rodents, which are important hosts for juvenile ticks.
In our study, 2.4% and 16.7% of D. marginatus and D. reticulatus larvae removed from small mammals (Apodemus spp. and Clethrionomys spp.) and one D. reticulatus male collected from vegetation tested positive for I. hookeri, respectively. Dermacentor spp. larvae and nymphs are nidicolous, feeding on the small mammals in their nests or burrow corridors. The association between the wasps’ infestation of nidicolous Dermacentor ticks and infection with rodent-associated pathogens suggests that wasps of this population are looking for the tick hosts while feeding on the rodents. The spectrum of rodent-related pathogens detected in juvenile Dermacentor ticks confirms this life strategy (Table 3 and Table 4).
A similar association was observed in the case of wasp-infested I. ricinus nymphs. These tested positive for Bartonella spp. (B. grahamii), Borreliella spp. (mostly B. garinii and B. afzelii), and Rickettsia spp. (mostly R. helvetica), suggesting that nymphs were injected by the wasps most probably while feeding on rodents. However, as we were not able to determine each pathogen at the species level, we cannot rule out the possibility that wasps injected ticks while feeding on other vertebrate hosts, such as deer. Several I. ricinus nymphs carried the DNA of B. bovis, which clusters phylogenetically with other ruminant-associated Bartonella species [66,67].
This is the first record of Iph. hookeri in two Dermacentor species in Slovakia and Central Europe. Previous studies from Europe suggested that this wasp preferred I. ricinus and H. concinna ticks, but the tick host preference can vary among Iph. hookeri populations [19,51]. For instance, the Iph. hookeri population in Germany did not lay eggs in D. reticulatus ticks, even in a no-choice situation under experimental conditions, unlike wasps from the former USSR [68]. In our study, the infested Dermacentor spp. ticks were removed as partially engorged larvae from small mammals, except for one questing male. The 28S rRNA genotype from D. marginatus was like the GP15 (MN956813) genotype from different tick species, including H. concinna and D. silvarum, from the Khekhtsir forest in Russia [46].
Haemaphysalis concinna ticks from our study carried several Babesia spp., which were highly similar to Babesia sp.2 (Eurasia) and some other isolates from Far Eastern Russia, (e.g., KH-Hc222/KT725849 or KJ486568). Additionally, previously obtained B. canis sequences from I. ricinus from western Slovakia clustered together in a well-supported clade with B. canis (AY649326), which was identified from D. reticulatus collected in Russia. Based on these similarities, we assume the phylogenetic relatedness and similarity of Iph. hookeri populations found in ticks from Slovakia with isolates from Russia, where the presence of Iph. hookeri has been confirmed in H. concinna, D. reticulatus, and D. silvarum ticks. Moreover, D. silvarum and D. marginatus, in which the presence of Iph. hookeri was also confirmed in our study, are considered closely related species, sharing a lot of certain characteristics [69].
As observed by Collatz et al. [19], Iph. hookeri populations exhibit significant variations based on their region, indicating that they are well adapted to local conditions. Our study found that different strains of Iph. hookeri can circulate among various tick species in the same area, but further research is required to confirm this hypothesis. Additionally, the presence of Wolbachia spp. in ticks infested by wasps suggests that it may be related to the presence of Iph. hookeri in ticks [61]. This theory has already been proposed in previous studies [5,8].
The study by Bobo [70] showed that the presence of Wolbachia significantly altered the native microbiome of ticks. Although ticks themselves do harbor the Wolbachia endosymbiont, it is present at a very low number. In our study, only three H. concinna ticks that were not infested by wasps carried the DNA of Wolbachia spp. Bobo [70] suggested that this may be due to a relationship between Wolbachia and Rickettsial endosymbionts in ticks. Ixodes ticks are often colonized by members of the genus Rickettsia, which is closely related to Wolbachia [71]. Bobo et al. [70] reported that the presence of two reproductive manipulators, Wolbachia and Rickettsia, places a heavy burden on the host. Thus, Wolbachia and Rickettsia exclude each other, which is why Ixodes ticks are negative for Wolbachia spp. but positive for Rickettsia spp. We observed a similar phenomenon in our study. Moreover, it is hypothesized that Wolbachia in ticks almost eliminates the presence of other endogenous microbes, which corresponds with the results of our study in the case of H. concinna ticks. In ticks, Wolbachia can promote colonization by Iph. hookeri. This approach involves manipulating the host immune system to promote symbiont proliferation and egg maintenance [8]. The presence of Wolbachia could induce an immune reaction in the tick that could eliminate, or harm, other microorganisms hosted by the tick, or on the contrary, it could create a suitable environment for some other microbes. However, more factors, including other members of microbiota as well as the various relationships among them, might be “behind the scenes”.
During our research, six tick species with different abilities and capacities to carry different groups and species of pathogens were examined. In I. ricinus and Dermacentor spp. ticks, it was observed that the presence of Wolbachia eliminated the presence of Rickettsia but did not influence the presence of other pathogens. The calculated values of the odds ratio also supported these results. However, the relationships and associations among pathogens in other tick species need to be further investigated.
In addition to maternally inherited bacteria, several other members of the microbiome have been observed to interact with tick-borne pathogens by either facilitating or inhibiting pathogen colonization and transmission. The results obtained by Lejal et al. [5] suggested that most correlations between the microbes are related to the presence of tick-borne pathogens (TBPs), the response to the parasitoid, or the seasonal effect.
Our study’s most prevalent microorganisms detected in ticks belonged to the genus Rickettsia spp. This was confirmed in each of the tested tick species, with the highest prevalence in I. ricinus, followed by H. inermis, D. reticulatus, D. marginatus, H. concinna, and I. trianguliceps. The most common species detected in I. ricinus and H. concinna ticks was R. helvetica, and members of the spotted fever group (SFG) rickettsiae in D. marginatus, D. reticulatus, and H. inermis ticks.
Ouarti et al. [72] confirmed the presence of R. raoulti in D. reticulatus and H. inermis ticks from the Karst area. Additionally, Heglasová et al. [32] screened tissue samples from 250 rodents of several species from the Slovak Karst and found a high prevalence of Rickettsia spp., some of which are considered pathogenic to humans. Rickettsia raoulti and R. slovaca are responsible for tick-borne lymphadenopathy/Dermacentor-borne necrosis erythema, lymphadenopathy/scalp eschar, and neck lymphadenopathy [71,72,73,74,75]. Diseases caused by rickettsiae are quite commonly reported in Slovakia [67,76,77]. As mentioned above, in this study, we confirmed the presence of R. helvetica in a great proportion of the examined I. ricinus ticks. Similarly, a high proportion of D. reticulatus and H. inermis ticks in our study carried the DNA of SFG Rickettsia spp., most presumably the species with zoonotic potential, such as R. raoulti and/or R. slovaca.
Borreliella burgdorferi sensu lato spirochetes have previously been found in questing and feeding I. ricinus (B. garinii and B. afzelii), D. reticulatus (B. afzelii), and H. inermis (B. valaisiana) ticks, with a significant predominance of genotypes associated with rodents and birds. Heglasová et al. [33] recently confirmed the presence of Borrelia miyamotoi, a relapsing fever group member, in I. ricinus, D. marginatus, D. reticulatus, H. concinna, and H. inermis from the Karst area. Borreliella spp. were found in over 20% of all I. ricinus nymphs tested in our study. Wasps infested several I. ricinus nymphs carrying spirochete DNA, suggesting that these parasitoids may interfere with the spread of Borreliella genotypes that cause Lyme disease [78,79]. Moreover, D. marginatus and D. reticulatus ticks from the sampling site have been shown to harbor Borreliella spp. as well. The majority of Dermacentor spp. ticks carrying spirochete DNA were found to be engorged larvae that were removed from small mammals; in many of these larvae, the presence of wasps was confirmed using PCR.
Bartonella spp. were the third most common microbe found molecularly in all tested tick species. Bartonella bovis was found in the majority of I. ricinus nymphs. This is the first report of the bacteria, which may cause endocarditis in cattle; the species has not yet been proven in Slovakia [80,81]. In this study, the presence of B. grahamii, which can cause cat scratch disease [82], and a Bartonella sp., which is closely related to B. grahamii, in D. marginatus and D. reticulatus ticks, was proved, respectively. Bartonella grahamii belongs to the most widespread species, occurring in wild mice (Apodemus spp.) and arvicolid voles (Myodes spp. and Microtus spp.) throughout Eurasia, from the UK to Japan [67,77,83,84,85], and it has been detected in several species of small mammals and ectoparasites in Slovakia as well [78,79].
Anaplasma spp. were found mostly in adult I. ricinus, H. inermis, D. reticulatus, and D. marginatus ticks and one H. concinna nymph. Blaňarová et al. [86,87] detected A. phagocytophilum in questing I. ricinus ticks and in rodent-feeding I. trianguliceps ticks, as well as in rodent biopsies, whereas it was not detected in rodents from the sites where I. trianguliceps ticks were absent. Phylogenetic analyses confirmed that A. phagocytophilum strains display specific host and vector associations and suggested that genotypes associated with rodents are probably transmitted solely by I. trianguliceps ticks, thus implying that rodent-associated strains may not pose a risk for humans. The blood meal of adult I. ricinus usually takes place on wild game animals, which are abundant in the study area. The Anaplasma phagocytophilum strains identified in questing I. ricinus ticks in this study showed a high similarity with several msp2 isolates from questing I. ricinus ticks, deer, or dogs in the Genbank (e.g., MK802162, MK802159, MK625091, and MK570959). Ouarti et al. [72] found that 1.15% of H. inermis ticks from the Karst area carried bacteria from the family Anaplasmataceae. Interestingly, the prevalence of Anaplasma spp. in H. inermis ticks in our study reached more than 10%, suggesting its non-negligible role in the circulation of this bacteria.
Multiplex qPCR testing of Dermacentor spp. and H. inermis ticks showed that Anaplasma spp. in these tick species do not correspond to the GroEl1 or GroEl2 ecotypes.
We only found adult Dermacentor ticks from vegetation that contained Anaplasma spp. All the juvenile ticks from rodents tested negative, indicating that they do not carry the rodent-related Anaplasma ecotype. Our findings do, however, suggest that they are involved in the spread of Anaplasma spp. at the study location. It is worthwhile to genotype the bacteria in these tick species to better understand the roles of Dermacentor spp. and H. inermis in the spread of Anaplasma sp. ecotypes.
After screening several tick species from a site in the Karst region, Bona et al. [88] found that Babesia spp., which were only present in I. ricinus, were the second most common pathogen in the ticks they studied. Ticks carried mostly B. microti, the “Jena” strain, and B. venatorum. Babesia spp. were found in all examined tick species in our study, but primarily in H. concinna nymphs. Theileria capreoli and Babesia sp. 2 (Eurasia) were highly prevalent in H. concinna nymphs after sequencing the positive samples. These isolates are similar to those from questing and rodent-attached H. concinna ticks from western Slovakia (KU550688 and KU550689) or to the Kh-Hc222 isolate from H. concinna ticks from Russia (KJ486568). Babesia motasi, which is responsible for babesiosis in small ruminants, was detected in H. concinna larvae. In I. ricinus ticks, mostly rodent-associated B. microti was detected, and sporadically, B. canis was confirmed in questing nymphs.
The risk of numerous bacterial and/or protozoal diseases in this area is high, both for humans and animals. For wasps to develop, the tick nymph must begin to feed on a vertebrate host, which increases the risk of pathogen transmission. However, reducing the tick population can be achieved by using Iph. hookeri wasps, which kill infested nymphs after the emergence of adult wasps. This prevents the nymphs from molting into adult tick females or males and transmitting pathogens to vertebrate hosts. Tick females are also important vectors of different pathogens, including Rickettsia spp. and Borreliella spp. These bacteria are transmitted to thousands of larvae through transovarial transmission, with a transmission rate of up to 100% for some Rickettsia spp. [80,81] and more than 90% for Borrelia miyamotoi [82,89]. Consequently, when the wasps kill infected nymphs, the trans-stadially transmitted pathogens will not be transmitted to adult ticks or further spread to vertebrate hosts via adult ticks. Moreover, for some Rickettsia species as well as some relapsing fever borreliae, sexual transmission from a male to a female tick during copulation has been described [90,91]. Ixodiphagus hookeri can infest many tick species and has the potential to control tick populations and prevent the spread of parasites and pathogens in the Karst area.

5. Conclusions

Global climate change, together with various socio-demographic changes, creates urgent challenges related to vectors carrying pathogens and the need to develop control methods and measures. The fight against vectors, mosquitoes, and ticks often consists of the conventional use of acaricides, and alternative approaches based on biological control remain in the background. One of the methods of combating vectors is the use of parasitoid wasps of the genus Ixodiphagus. Monitoring the occurrence and host preference of wasps in areas with a sympatric occurrence of several epidemiologically important species of ticks that transmit specific types of pathogens and parasites is of indisputable importance from the point of protecting human and animal health. In this study, we identified the presence of wasps in four epidemiologically significant tick species of three genera. Many of them carry pathogens with the ability to cause serious diseases in humans and animals. Identifying and understanding tick-borne microbe interactions is essential for understanding the dynamics of vector-borne diseases and a precondition for the development of new strategies to control ticks and tick-borne diseases using the tick microbiome.

Author Contributions

V.B.: investigation, analyses, methodology, data processing, and original manuscript/draft writing; M.S.: field collections, supervision, original manuscript/draft writing, and editing; H.S.: analyses, investigation, methodology, and original manuscript/draft editing; R.K.: molecular analyses; L.V.: molecular analyses; D.Z.: original manuscript/draft review and editing; M.B.: field collections and statistical analyses; D.M.: statistical analyses; B.V.: conceptualization, methodology, data curation, formal analysis, resources, supervision, project administration, funding acquisition, and original manuscript/draft writing. All authors have read and agreed to the published version of the manuscript.

Funding

This study was realized thanks to the financial support from the projects VEGA 2/0014/21, VEGA 2/0051/24, and APVV-21-0166. HS and RK were financially supported by the Dutch Ministry of Health, Welfare and Sport (VWS). The funders had no role in the study design and interpretation or the decision to submit the work for publication.

Institutional Review Board Statement

The animal study protocol was approved by the Institutional Review Board of Institute of Parasitology. Captured small mammals were euthanized in accordance with the licenses of the Ministry of Environment of the Slovak Republic No. 4874/2011–2.2 and 4559/2015–2.3.

Informed Consent Statement

Not applicable.

Data Availability Statement

The original contributions presented in the study are included in the article, further inquiries can be directed to the corresponding author/s. The raw data supporting the conclusions of this article will be made available by the authors on request.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Sonenshine, D.E.; Lane, R.S.; Nicholson, W.L. TICKS (Ixodida). In Medical and Veterinary Entomology; Mullen, G., Durden, L., Eds.; Academic Press: San Diego, CA, USA, 2002; pp. 517–558. ISBN 978-0-12-510451-7. [Google Scholar]
  2. Wikel, S.K. Ticks and Tick-Borne Infections: Complex Ecology, Agents, and Host Interactions. Vet. Sci. 2018, 5, 60. [Google Scholar] [CrossRef]
  3. Showler, A.T.; Saelao, P. Integrative Alternative Tactics for Ixodid Control. Insects 2022, 13, 302. [Google Scholar] [CrossRef]
  4. Budachetri, K.; Kumar, D.; Crispell, G.; Beck, C.; Dasch, G.; Karim, S. The Tick Endosymbiont Candidatus Midichloria Mitochondrii and Selenoproteins Are Essential for the Growth of Rickettsia Parkeri in the Gulf Coast Tick Vector. Microbiome 2018, 6, 141. [Google Scholar] [CrossRef]
  5. Lejal, E.; Chiquet, J.; Aubert, J.; Robin, S.; Estrada-Peña, A.; Rue, O.; Midoux, C.; Mariadassou, M.; Bailly, X.; Cougoul, A.; et al. Temporal Patterns in Ixodes Ricinus Microbial Communities: An Insight into Tick-Borne Microbe Interactions. Microbiome 2021, 9, 153. [Google Scholar] [CrossRef] [PubMed]
  6. Pollet, T.; Sprong, H.; Lejal, E.; Krawczyk, A.I.; Moutailler, S.; Cosson, J.-F.; Vayssier-Taussat, M.; Estrada-Peña, A. The Scale Affects Our View on the Identification and Distribution of Microbial Communities in Ticks. Parasit. Vectors 2020, 13, 36. [Google Scholar] [CrossRef]
  7. Shi, H.; Yu, X.; Cheng, G. Impact of the Microbiome on Mosquito-Borne Diseases. Protein Cell 2023, 14, 743–761. [Google Scholar] [CrossRef]
  8. Plantard, O.; Bouju-Albert, A.; Malard, M.-A.; Hermouet, A.; Capron, G.; Verheyden, H. Detection of Wolbachia in the Tick Ixodes Ricinus Is Due to the Presence of the Hymenoptera Endoparasitoid Ixodiphagus hookeri. PLoS ONE 2012, 7, e30692. [Google Scholar] [CrossRef] [PubMed]
  9. Duron, O.; Binetruy, F.; Noël, V.; Cremaschi, J.; McCoy, K.D.; Arnathau, C.; Plantard, O.; Goolsby, J.; Pérez De León, A.A.; Heylen, D.J.A.; et al. Evolutionary Changes in Symbiont Community Structure in Ticks. Mol. Ecol. 2017, 26, 2905–2921. [Google Scholar] [CrossRef]
  10. Guizzo, M.G.; Neupane, S.; Kucera, M.; Perner, J.; Frantová, H.; da Silva Vaz, I.J.; de Oliveira, P.L.; Kopacek, P.; Zurek, L. Poor Unstable Midgut Microbiome of Hard Ticks Contrasts With Abundant and Stable Monospecific Microbiome in Ovaries. Front. Cell. Infect. Microbiol. 2020, 10, 211. [Google Scholar] [CrossRef]
  11. Krawczyk, A.I.; Röttjers, L.; Fonville, M.; Takumi, K.; Takken, W.; Faust, K.; Sprong, H. Quantitative Microbial Population Study Reveals Geographical Differences in Bacterial Symbionts of Ixodes Ricinus. Microbiome 2022, 10, 120. [Google Scholar] [CrossRef]
  12. Lalah, J.O.; Otieno, P.O.; Odira, Z.; Ogunah, J.A.; Lalah, J.O.; Otieno, P.O.; Odira, Z.; Ogunah, J.A. Pesticides: Chemistry, Manufacturing, Regulation, Usage and Impacts on Population in Kenya. In Pesticides—Updates on Toxicity, Efficacy and Risk Assessment; Larramendy, M.L., Soloneski, S., Eds.; IntechOpen: London, UK, 2022; ISBN 978-1-80356-039-7. [Google Scholar] [CrossRef]
  13. Pathak, V.M.; Verma, V.K.; Rawat, B.S.; Kaur, B.; Babu, N.; Sharma, A.; Dewali, S.; Yadav, M.; Kumari, R.; Singh, S.; et al. Current Status of Pesticide Effects on Environment, Human Health and It’s Eco-Friendly Management as Bioremediation: A Comprehensive Review. Front. Microbiol. 2022, 13, 962619. [Google Scholar] [CrossRef] [PubMed]
  14. Samsináková, A.; Kálalová, S.; Daniel, M.; Dusbábek, F.; Honzáková, E.; Cerný, V. Entomogenous Fungi Associated with the Tick Ixodes ricinus (L.). Folia Parasitol. 1974, 21, 39–48. [Google Scholar]
  15. Samish, M.; Rehacek, J. Pathogens and Predators of Ticks and Their Potential in Biological Control. Annu. Rev. Entomol. 1999, 44, 159–182. [Google Scholar] [CrossRef] [PubMed]
  16. Samish, M.; Glazer, I. Entomopathogenic Nematodes for the Biocontrol of Ticks. Trends Parasitol. 2001, 17, 368–371. [Google Scholar] [CrossRef] [PubMed]
  17. Hu, R.; Hyland, K.E.; Oliver, J.H. A Review on the Use of Ixodiphagus Wasps (Hymenoptera: Encyrtidae) as Natural Enemies for the Control of Ticks (Acari: Ixodidae). Syst. Appl. Acarol. 1998, 3, 19–28. [Google Scholar] [CrossRef]
  18. Tóth, A.G.; Farkas, R.; Gyurkovszky, M.; Krikó, E.; Solymosi, N. First Detection of Ixodiphagus hookeri (Hymenoptera: Encyrtidae) in Ixodes Ricinus Ticks (Acari: Ixodidae) from Multiple Locations in Hungary. Sci. Rep. 2023, 13, 1624. [Google Scholar] [CrossRef] [PubMed]
  19. Collatz, J.; Selzer, P.; Fuhrmann, A.; Oehme, R.M.; Mackenstedt, U.; Kahl, O.; Steidle, J.L.M. A Hidden Beneficial: Biology of the Tick-Wasp Ixodiphagus hookeri in Germany. J. Appl. Entomol. 2011, 135, 351–358. [Google Scholar] [CrossRef]
  20. Takasu, K.; Nakamura, S. Life History of the Tick Parasitoid Ixodiphagus hookeri (Hymenoptera: Encyrtidae) in Kenya. Biol. Control 2008, 46, 114–121. [Google Scholar] [CrossRef]
  21. Demas, F.A.; Hassanali, A.; Mwangi, E.N.; Kunjeku, E.C.; Mabveni, A.R. Cattle and Amblyomma Variegatum Odors Used in Host Habitat and Host Finding by the Tick Parasitoid, Ixodiphagus hookeri|Semantic Scholar. Available online: https://www.semanticscholar.org/paper/Cattle-and-Amblyomma-variegatum-Odors-Used-in-Host-Demas-Hassanali/4ad918160efdac6dd5b05c40eca504be8ef3ce0a (accessed on 27 April 2024).
  22. Alfeev, N.I.; Klimas, Y.V. On the Possibility of Develo** Ichneumon Flies, Hunterellus Hookeri in Climatic Conditions of the USSR. Sov. Vet. 1938, 15, 55. [Google Scholar]
  23. Hu, R.; Hyland, K.E. Prevalence and Seasonal Activity of the Wasp Parasitoid, Jxodiphagus Hookeri (Hymenoptera: Encyrtidae) in Its Tick Host, Ixodes Scapularis (Acari: Ixodidae). Syst. Appl. Acarol. 1997, 2, 95–100. [Google Scholar] [CrossRef]
  24. Logan, T.M.; Bowman, J.L.; Hair, J.A. Parthenogenesis and Overwintering Behavior in Ixodiphagus texanus Howard. J. Agric. Entomol. 1985, 2, 272–276. [Google Scholar]
  25. Davis, A.J. Bibliography of the Ixodiphagini (Hymenoptera, Chalcidoidea, Encyrtidae), Parasites of Ticks (Acari, Ixodidae), with Notes on Their Biology. Tijdschr. Voor Entomol. 1986, 129, 181–190. [Google Scholar]
  26. Davis, A.J.; Campbell, A. Ixodiphagus Texanus Howard (Hymenoptera: Encyrtidae) a Parasite of the Rabbit Tick in Nova Scotia. Can. J. Zool. 1979, 57, 1164–1166. [Google Scholar] [CrossRef]
  27. Bohacsova, M.; Mediannikov, O.; Kazimirova, M.; Raoult, D.; Sekeyova, Z. Arsenophonus Nasoniae and Rickettsiae Infection of Ixodes Ricinus Due to Parasitic Wasp Ixodiphagus hookeri. PLoS ONE 2016, 11, e0149950. [Google Scholar] [CrossRef] [PubMed]
  28. Lapin, M.; Faško, P.; Melo, M.; Šťastný, P.; Tomlain, J. Klimatické oblasti. In Atlas Kra**y Slovenskej Republiky; Ministry of Environment of the Slovak Republic Bratislava: Bratislava, Slovak Republic, 2002; p. 95. ISBN 80-88833-27-2. (In Slovak) [Google Scholar]
  29. Ginsberg, H.S.; Ewing, C.P. Comparison of Flagging, Walking, Trap**, and Collecting from Hosts as Sampling Methods for Northern Deer Ticks, Ixodes dammini, and Lone-Star Ticks, Amblyomma americanum (Acari:Ixodidae). Exp. Appl. Acarol. 1989, 7, 313–322. [Google Scholar] [CrossRef] [PubMed]
  30. Filippova, N.A. Arachnida Class: Ixodid Ticks of the Subfamily Ixodinae. 1977. Available online: https://scholar.google.com/scholar_lookup?&title=Ixodid%20ticks%20of%20the%20subfamily%20Ixodinae&journal=Fauna%20SSSR%2C%20Paukoobraznye&volume=4&publication_year=1977&author=Filippova%2CNA#d=gs_cit&t=1714220291288&u=%2Fscholar%3Fq%3Dinfo%3AMo0R8nGzA7wJ%3Ascholar.google.com%2F%26output%3Dcite%26scirp%3D0%26hl%3Den (accessed on 27 April 2024).
  31. Buczek, A.; Buczek, W.; Bartosik, K.; Kulisz, J.; Stanko, M. Ixodiphagus hookeri Wasps (Hymenoptera: Encyrtidae) in Two Sympatric Tick Species Ixodes Ricinus and Haemaphysalis Concinna (Ixodida: Ixodidae) in the Slovak Karst (Slovakia): Ecological and Biological Considerations. Sci. Rep. 2021, 11, 11310. [Google Scholar] [CrossRef] [PubMed]
  32. Heglasová, I.; Víchová, B.; Kraljik, J.; Mošanský, L.; Miklisová, D.; Stanko, M. Molecular Evidence and Diversity of the Spotted-Fever Group Rickettsia Spp. in Small Mammals from Natural, Suburban and Urban Areas of Eastern Slovakia. Ticks Tick-Borne Dis. 2018, 9, 1400–1406. [Google Scholar] [CrossRef]
  33. Heglasová, I.; Rudenko, N.; Golovchenko, M.; Zubriková, D.; Miklisová, D.; Stanko, M. Ticks, Fleas and Rodent-Hosts Analyzed for the Presence of Borrelia Miyamotoi in Slovakia: The First Record of Borrelia Miyamotoi in a Haemaphysalis Inermis Tick. Ticks Tick-Borne Dis. 2020, 11, 101456. [Google Scholar] [CrossRef]
  34. Radzijevskaja, J.; Paulauskas, A.; Aleksandraviciene, A.; Jonauskaite, I.; Stanko, M.; Karbowiak, G.; Petko, B. New Records of Spotted Fever Group Rickettsiae in Baltic Region. Microbes Infect. 2015, 17, 874–878. [Google Scholar] [CrossRef]
  35. Cowling, D.W.; Gardner, I.A.; Johnson, W.O. Comparison of Methods for Estimation of Individual-Level Prevalence Based on Pooled Samples. Prev. Vet. Med. 1999, 39, 211–225. [Google Scholar] [CrossRef]
  36. Guy, E.C.; Stanek, G. Detection of Borrelia Burgdorferi in Patients with Lyme Disease by the Polymerase Chain Reaction. J. Clin. Pathol. 1991, 44, 610–611. [Google Scholar] [CrossRef] [PubMed]
  37. Krawczyk, A.I.; Bakker, J.W.; Koenraadt, C.J.M.; Fonville, M.; Takumi, K.; Sprong, H.; Demir, S. Tripartite Interactions among Ixodiphagus hookeri, Ixodes Ricinus and Deer: Differential Interference with Transmission Cycles of Tick-Borne Pathogens. Pathogens 2020, 9, 339. [Google Scholar] [CrossRef]
  38. de Leeuw, B.H.C.G.M.; Maraha, B.; Hollemans, L.; Sprong, H.; Brandenburg, A.H.; Westenend, P.J.; Kusters, J.G. Evaluation of Borrelia Real Time PCR DNA Targeting OspA, FlaB and 5S-23S IGS and Borrelia 16S rRNA RT-qPCR. J. Microbiol. Methods 2014, 107, 41–46. [Google Scholar] [CrossRef]
  39. Coipan, E.C.; Fonville, M.; Tijsse-Klasen, E.; van der Giessen, J.W.B.; Takken, W.; Sprong, H.; Takumi, K. Geodemographic Analysis of Borrelia Burgdorferi Sensu Lato Using the 5S-23S rDNA Spacer Region. Infect. Genet. Evol. J. Mol. Epidemiol. Evol. Genet. Infect. Dis. 2013, 17, 216–222. [Google Scholar] [CrossRef]
  40. Azagi, T.; Hoeve-Bakker, B.J.A.; Jonker, M.; Roelfsema, J.H.; Sprong, H.; Kerkhof, K. Technical Evaluation of qPCR Multiplex Assays for the Detection of Ixodes Ricinus-Borne Pathogens. Microorganisms 2022, 10, 2222. [Google Scholar] [CrossRef]
  41. Eberts, M.D.; Vissotto de Paiva Diniz, P.P.; Beall, M.J.; Stillman, B.A.; Chandrashekar, R.; Breitschwerdt, E.B. Typical and Atypical Manifestations of Anaplasma Phagocytophilum Infection in Dogs. J. Am. Anim. Hosp. Assoc. 2011, 47, e86–e94. [Google Scholar] [CrossRef]
  42. Derdáková, M.; Beati, L.; Pet’ko, B.; Stanko, M.; Fish, D. Genetic Variability within Borrelia Burgdorferi Sensu Lato Genospecies Established by PCR-Single-Strand Conformation Polymorphism Analysis of the rrfA-rrlB Intergenic Spacer in Ixodes Ricinus Ticks from the Czech Republic. Appl. Environ. Microbiol. 2003, 69, 509–516. [Google Scholar] [CrossRef]
  43. Diaz, M.H.; Bai, Y.; Malania, L.; Winchell, J.M.; Kosoy, M.Y. Development of a Novel Genus-Specific Real-Time PCR Assay for Detection and Differentiation of Bartonella Species and Genotypes. Available online: https://www.researchgate.net/publication/221874549_Development_of_a_Novel_Genus-Specific_Real-Time_PCR_Assay_for_Detection_and_Differentiation_of_Bartonella_Species_and_Genotypes (accessed on 27 April 2024).
  44. Regnery, R.L.; Spruill, C.L.; Plikaytis, B.D. Genotypic Identification of Rickettsiae and Estimation of Intraspecies Sequence Divergence for Portions of Two Rickettsial Genes. J. Bacteriol. 1991, 173, 1576–1589. [Google Scholar] [CrossRef]
  45. Casati, S.; Sager, H.; Gern, L.; Piffaretti, J.C. Presence of Potentially Pathogenic Babesia Sp. for Human in Ixodes Ricinus in Switzerland. Ann. Agric. Environ. Med. 2006, 13, 65–70. [Google Scholar] [PubMed]
  46. Gaye, M.; Amanzougaghene, N.; Laidoudi, Y.; Niang, E.H.A.; Sekeyová, Z.; Laroche, M.; Bérenger, J.-M.; Raoult, D.; Kazimírová, M.; Fenollar, F.; et al. Hymenopteran Parasitoids of Hard Ticks in Western Africa and the Russian Far East. Microorganisms 2020, 8, 1992. [Google Scholar] [CrossRef]
  47. Tamura, K.; Stecher, G.; Kumar, S. MEGA11: Molecular Evolutionary Genetics Analysis Version 11. Mol. Biol. Evol. 2021, 38, 3022–3027. [Google Scholar] [CrossRef]
  48. Klyushkina, E.A. A Parasite of the Ixodid Ticks, Hunterellus hookeri How. in the Crimea. Zool. Zh 1958, 37, 1561–1563. [Google Scholar]
  49. Howard, L.O. “A Chalcidoid Parasite of a Tick”. Entomological News, and Proceedings of the Entomological Section of the Academy of Natural Sciences of Philadelphia 18, 375–378. 1907. Available online: https://ia801707.us.archive.org/12/items/biostor-3844/biostor-3844.pdf (accessed on 1 January 2023).
  50. Stafford, K.C.; Denicola, A.J.; Kilpatrick, H.J. Reduced Abundance of Ixodes Scapularis (Acari: Ixodidae) and the Tick Parasitoid Ixodiphagus hookeri (Hymenoptera: Encyrtidae) with Reduction of White-Tailed Deer. J. Med. Entomol. 2003, 40, 642–652. [Google Scholar] [CrossRef] [PubMed]
  51. Ramos, R.A.N.; de Macedo, L.O.; Bezerra-Santos, M.A.; de Carvalho, G.A.; Verocai, G.G.; Otranto, D. The Role of Parasitoid Wasps, Ixodiphagus Spp. (Hymenoptera: Encyrtidae), in Tick Control. Pathogens 2023, 12, 676. [Google Scholar] [CrossRef]
  52. Cooley, R.A.; Kohls, G.M.; Cooley, R.A.; Kohls, G.M. A Summary on Tick Parasites. Proc. Pac. Sci. Congr. Pac. Sci. Assoc. 1933, 5, 3375–3381. [Google Scholar]
  53. Wood, H.P. Notes on the Life History of the Tick Parasite. J. Econ. Entomol. 1911, 4, 425–431. [Google Scholar] [CrossRef]
  54. Stafford, K.C.; Denicola, A.J.; Magnarelli, L.A. Presence of Ixodiphagus hookeri (Hymenoptera: Encyrtidae) in Two Connecticut Populations of Ixodes Scapularis (Acari: Ixodidae). J. Med. Entomol. 1996, 33, 183–188. [Google Scholar] [CrossRef]
  55. Mather, T.N.; Piesman, J.; Spielman, A. Absence of Spirochaetes (Borrelia burgdorferi) and Piroplasms (Babesia microti) in Deer Ticks (Ixodes dammini) Parasitized by Chalcid Wasps (Hunterellus hookeri). Med. Vet. Entomol. 1987, 1, 3–8. [Google Scholar] [CrossRef]
  56. Bouček, Z.; Černỳ, V. Cizopasník Klístat, Chalcidka Hunterellus Hookeri How. v CSR. Folia Zool. Entomol. 1954, 3, 109–111. [Google Scholar]
  57. Doby, J.M.; Van Laere, G. Hunterellus hookeri Howard, 1907, Hymenoptère Chalcididae Parasite de La Tique Ixodes Ricinus Dans l’ouest et Le Centre de La France. Bull. Société Fr. Parasitol. 1993, 11, 265–270. [Google Scholar]
  58. Japoshvili, G. New Records of Encyrtids (Hymenoptera: Chalcidoidea: Encyrtidae) from Georgia, with Description of Seven New Species. J. Asia-Pac. Entomol. 2017, 20, 866–877. [Google Scholar] [CrossRef]
  59. Collatz, J.; Fuhrmann, A.; Selzer, P.; Oehme, R.M.; Hartelt, K.; Kimmig, P.; Meiners, T.; Mackenstedt, U.; Steidle, J.L.M. Being a Parasitoid of Parasites: Host Finding in the Tick Wasp Ixodiphagus hookeri by Odours from Mammal. Entomol. Exp. Appl. 2010, 134, 131–137. [Google Scholar] [CrossRef]
  60. Walter, G. Beitrag zur Biologie der Schlupfwespe Hunterellus hookeri Howard (Hymenoptera: Encyrtidae) in Norddeutschland. Beitr. Naturkunde Niedersachs. 1980, 33, 129–133. [Google Scholar]
  61. Tijsse-Klasen, E.; Braks, M.; Scholte, E.-J.; Sprong, H. Parasites of Vectors—Ixodiphagus hookeri and Its Wolbachia Symbionts in Ticks in The Netherlands. Parasit. Vectors 2011, 4, 228. [Google Scholar] [CrossRef] [PubMed]
  62. Sormunen, J.J.; Sippola, E.; Kaunisto, K.M.; Vesterinen, E.J.; Sääksjärvi, I.E. First evidence of Ixodiphagus hookeri (Hymenoptera: Encyrtidae) parasitization in Finnish castor bean ticks (Ixodes ricinus). Exp. Appl. Acarol. 2019, 79, 395–404. [Google Scholar] [CrossRef] [PubMed]
  63. Luu, L.; Palomar, A.M.; Farrington, G.; Schilling, A.-K.; Premchand-Branker, S.; McGarry, J.; Makepeace, B.L.; Meredith, A.; Bell-Sakyi, L. Bacterial Pathogens and Symbionts Harboured by Ixodes Ricinus Ticks Parasitising Red Squirrels in the United Kingdom. Pathogens 2021, 10, 458. [Google Scholar] [CrossRef]
  64. Rehácek, J.; Kocianová, E. Attempt to Infect Hunterellus Hookeri Howard (Hymenoptera, Encyrtidae), an Endoparasite of Ticks, with Coxiella Burnetti. Acta Virol. 1992, 36, 492. [Google Scholar] [PubMed]
  65. Slovak, M. Finding of the Endoparasitoid Ixodiphagus hookeri (Hymenoptera, Encyrtidae) in Haemaphysalis Concinna Ticks in Slovakia. Biologia 2003, 58, 890–894. [Google Scholar]
  66. Tay, S.T.; Kho, K.L.; Lye, S.F.; Ngeow, Y.F. Phylogeny and Putative Virulence Gene Analysis of Bartonella Bovis. J. Vet. Med. Sci. 2018, 80, 653–661. [Google Scholar] [CrossRef] [PubMed]
  67. Deng, H.; Le Rhun, D.; Buffet, J.-P.R.; Cotté, V.; Read, A.; Birtles, R.J.; Vayssier-Taussat, M. Strategies of Exploitation of Mammalian Reservoirs by Bartonella Species. Vet. Res. 2012, 43, 15. [Google Scholar] [CrossRef]
  68. Alfeev, N.I. The utilization of Hunterellus hookeri How. for the control of the ticks, Ixodes ricinus L. and Ixodes persulcatus P. Sch. with reference to peculiarities of their metamorphosis under conditions of the Province of Lenningrad. Rev. Appl. Ent. B 1946, 34, 108–109. [Google Scholar]
  69. Wang, F.; Wang, D.; Guo, G.; Hu, Y.; Wei, J.; Liu, J. Species Delimitation of the Dermacentor Ticks Based on Phylogenetic Clustering and Niche Modeling. PeerJ 2019, 7, e6911. [Google Scholar] [CrossRef] [PubMed]
  70. Bobo, C.G. Molecular Characterization of Wolbachia and Its Impact on the Microbiome of Exotic and United States Ticks. Honors Theses. 2020. Available online: https://aquila.usm.edu/honors_theses/702 (accessed on 1 January 2023).
  71. Parola, P.; Paddock, C.D.; Socolovschi, C.; Labruna, M.B.; Mediannikov, O.; Kernif, T.; Abdad, M.Y.; Stenos, J.; Bitam, I.; Fournier, P.-E.; et al. Update on Tick-Borne Rickettsioses around the World: A Geographic Approach. Clin. Microbiol. Rev. 2013, 26, 657–702. [Google Scholar] [CrossRef] [PubMed]
  72. Ouarti, B.; Hamzaoui, B.E.; Stanko, M.; Laroche, M.; Mediannikov, O.; Parola, P.; Sekeyová, Z. Detection of Rickettsia Raoultii in Dermacentor Reticulatus and Haemaphysalis Inermis Ticks in Slovakia. Biologia 2022, 77, 1611–1617. [Google Scholar] [CrossRef]
  73. Ibarra, V.; Oteo, J.A.; Portillo, A.; Santibáñez, S.; Blanco, J.R.; Metola, L.; Eiros, J.M.; Pérez-Martínez, L.; Sanz, M. Rickettsia slovaca Infection: DEBONEL/TIBOLA—IBARRA—2006—Annals of the New York Academy of Sciences—Wiley Online Library. Available online: https://nyaspubs.onlinelibrary.wiley.com/doi/abs/10.1196/annals.1374.040 (accessed on 27 April 2024).
  74. Oteo, J.A.; Ibarra, V.; Blanco, J.R.; Martínez De Artola, V.; Márquez, F.J.; Portillo, A.; Raoult, D.; Anda, P. Dermacentor-Borne Necrosis Erythema and Lymphadenopathy: Clinical and Epidemiological Features of a New Tick-Borne Disease. Clin. Microbiol. Infect. 2004, 10, 327–331. [Google Scholar] [CrossRef] [PubMed]
  75. Selmi, M.; Bertolotti, L.; Tomassone, L.; Mannelli, A. Rickettsia Slovaca in Dermacentor Marginatus and Tick-Borne Lymphadenopathy, Tuscany, Italy. Emerg. Infect. Dis. 2008, 14, 817–820. [Google Scholar] [CrossRef] [PubMed]
  76. Špitalská, E.; Sparagano, O.; Stanko, M.; Schwarzová, K.; Špitalský, Z.; Škultéty, Ľ.; Havlíková, S.F. Diversity of Coxiella-like and Francisella-like Endosymbionts, and Rickettsia spp., Coxiella Burnetii as Pathogens in the Tick Populations of Slovakia, Central Europe. Ticks Tick-Borne Dis. 2018, 9, 1207–1211. [Google Scholar] [CrossRef] [PubMed]
  77. Buffet, J.-P.; Pisanu, B.; Brisse, S.; Roussel, S.; Félix, B.; Halos, L.; Chapuis, J.-L.; Vayssier-Taussat, M. Deciphering Bartonella Diversity, Recombination, and Host Specificity in a Rodent Community. PLoS ONE 2013, 8, e68956. [Google Scholar] [CrossRef] [PubMed]
  78. Kraljik, J.; Stanko, M.; Blaňárová, L.; Miklisová, D.; Mošanský, L.; Bona, M. Ticks and Fleas on Small Mam-Mals in Natural Foci of Eastern Slovakia. In Proceedings of the Joint 8th International Ticks and Tick-Borne Pathogens (TTP-8) and 12th Biennial Society for Tropical Veterinary Medicine (STVM) Conference, Cape Town, South Africa, 24–29 August 2014. [Google Scholar]
  79. Kraljik, J.; Paziewska-Harris, A.; Miklisová, D.; Blaňarová, L.; Mošanský, L.; Bona, M.; Stanko, M. Genetic Diversity of Bartonella Genotypes Found in the Striped Field Mouse (Apodemus agrarius) in Central Europe. Parasitology 2016, 143, 1437–1442. [Google Scholar] [CrossRef]
  80. Burgdorfer, W.; Brinton, L.P. Mechanisms of Transovarial Infection of Spotted Fever Rickettsiae in Ticks. Ann. N. Y. Acad. Sci. 1975, 266, 61–72. [Google Scholar] [CrossRef]
  81. Socolovschi, C.; Mediannikov, O.; Raoult, D.; Parola, P. The Relationship between Spotted Fever Group Rickettsiae and Ixodid Ticks. Vet. Res. 2009, 40, 34. [Google Scholar] [CrossRef]
  82. Scoles, G.A.; Papero, M.; Beati, L.; Fish, D. A Relapsing Fever Group Spirochete Transmitted by Ixodes Scapularis Ticks. Vector Borne Zoonotic Dis. Larchmt. N 2001, 1, 21–34. [Google Scholar] [CrossRef] [PubMed]
  83. Knap, N.; Duh, D.; Birtles, R.; Trilar, T.; Petrovec, M.; Avšič-Županc, T. Molecular Detection of Bartonella Species Infecting Rodents in Slovenia. FEMS Immunol. Med. Microbiol. 2007, 50, 45–50. [Google Scholar] [CrossRef] [PubMed]
  84. Berglund, E.C.; Ellegaard, K.M.; Granberg, F.; **e, Z.; Maruyama, S.; Kosoy, M.Y.; Birtles, R.J.; Andersson, S.G. Rapid Diversification by Recombination in Bartonella Grahamii from Wild Rodents in Asia Contrasts with Low Levels of Genomic Divergence in Northern Europe and America. Mol. Ecol. 2010, 19, 2241–2255. [Google Scholar] [CrossRef] [PubMed]
  85. Paziewska, A.; Harris, P.D.; Zwolińska, L.; Bajer, A.; Siński, E. Recombination Within and Between Species of the Alpha Proteobacterium Bartonella Infecting Rodents. Microb. Ecol. 2011, 61, 134–145. [Google Scholar] [CrossRef] [PubMed]
  86. Pangrácová, L.; Derdáková, M.; Pekárik, L.; Hviščová, I.; Víchová, B.; Stanko, M.; Hlavatá, H.; Peťko, B. Ixodes Ricinus Abundance and Its Infection with the Tick-Borne Pathogens in Urban and Suburban Areas of Eastern Slovakia. Parasit. Vectors 2013, 6, 238. [Google Scholar] [CrossRef]
  87. Blaňarová, L.; Stanko, M.; Carpi, G.; Miklisová, D.; Víchová, B.; Mošanský, L.; Bona, M.; Derdáková, M. Distinct Anaplasma Phagocytophilum Genotypes Associated with Ixodes Trianguliceps Ticks and Rodents in Central Europe. Ticks Tick-Borne Dis. 2014, 5, 928–938. [Google Scholar] [CrossRef] [PubMed]
  88. Bona, M.; Blaňárová, L.; Stanko, M.; Mošanský, L.; Čepčeková, E.; Víchová, B. Impact of Climate Factors on the Seasonal Activity of Ticks and Temporal Dynamics of Tick-Borne Pathogens in an Area with a Large Tick Species Diversity in Slovakia, Central Europe. Biologia 2022, 77, 1619–1631. [Google Scholar] [CrossRef]
  89. Richter, D.; Debski, A.; Hubalek, Z.; Matuschka, F.-R. Absence of Lyme Disease Spirochetes in Larval Ixodes Ricinus Ticks. Vector Borne Zoonotic Dis. Larchmt. 2012, 12, 21–27. [Google Scholar] [CrossRef]
  90. Hayes, S.F.; Burgdorfer, W.; Aeschlimann, A. Sexual Transmission of Spotted Fever Group Rickettsiae by Infected Male Ticks: Detection of Rickettsiae in Immature Spermatozoa of Ixodes Ricinus. Infect. Immun. 1980, 27, 638–642. [Google Scholar] [CrossRef]
  91. Gaber, M.S.; Khalil, G.M.; Hoogstraal, H. Borrelia Crocidurae: Venereal Transfer in Egyptian Ornithodoros Erraticus Ticks. Exp. Parasitol. 1982, 54, 182–184. [Google Scholar] [CrossRef]
Figure 1. Spectrum of tick-borne pathogens in different tick species. (a) I. ricinus; (b) H. concinna; (c) H. inermis; (d) D. reticulatus; (e) D. marginatus.
Figure 1. Spectrum of tick-borne pathogens in different tick species. (a) I. ricinus; (b) H. concinna; (c) H. inermis; (d) D. reticulatus; (e) D. marginatus.
Pathogens 13 00385 g001
Table 2. Prevalence of pathogens detected in questing I. ricinus and H. concinna ticks.
Table 2. Prevalence of pathogens detected in questing I. ricinus and H. concinna ticks.
Prevalence of Pathogens Detected in Questing I. ricinus (%)
Developmental StageTotal No. of Examined TicksInfestation with Iph. hookeriPrevalence (%) MIR * (%)Iph. hookeriWolbachia spp.Borreliella spp.Babesia spp./Theileria spp.Anaplasma spp.Bartonella spp.Rickettsia spp.
Male154NegativePrevalence (%) (no. of positive ticks)00(n = 29) 18.830(n = 14) 9.09(n = 5) 3.25(n = 14) 9.09
Female14900(n = 34) 22.81(n = 2) 1.34(n = 8) 5.37(n = 8) 5.37(n = 16) 10.74
Nymph2790(n = 1) 0.36(n = 49) 17.56(n = 2) 0.72(n = 1) 0.36(n = 60) 21.51(n = 24) 8.60
21Positive (n = 21) 100(n = 21) 100(n = 6) 28.5700(n = 7) 33.33(n = 1) 4.76
Total no. of wasp-free ticks582Negative 0(n = 1) 0.17(n = 112) 19.24(n = 4) 0.69(n = 23) 3.95(n = 73) 12.54(n = 54) 9.28
Total 603 Overall prevalence (%)(n = 21) 3.48(n = 22) 3.65 (n = 118) 19.57(n = 4) 0.66(n = 23) 3.81(n = 80) 13.27(n = 55) 9.12
Larvae100 pools of 10 larvae MIR (%)000(n = 2) 2(n = 4) 4(n = 4) 4(n = 28) 28
Prevalence of Pathogens Detected in Questing H. concinna (%)
Female3NegativePrevalence (%) (no. of positive ticks)02/300000
Nymph2740(n = 1) 0.370(n = 27) 9.850(n = 7) 2.56(n = 6) 2.19
23Positive (n = 23) 100(n = 21) 91.300(n = 1) 4.3500
Total no. of wasp-free ticks277Negative 0(n = 3) 1.080(n = 27) 9.750(n = 7) 2.53(n = 6) 2.17
Total300 Overall prevalence (%)(n = 23) 7.67(n = 24) 8.000(n = 27) 9.00(n = 1) 0.33(n = 7) 2.33(n = 6) 2.00
Larvae92 pools of 10 larvaeNegativeMIR (%)000(n = 2) 2.1700(n = 3) 3.26
2 pools of 10
larvae
Positive 2/2000001/2
Total94 pools Overall MIR (%)(n = 2) 2.1300(n = 2) 2.1300(n = 4) 4.26
* MIR—minimum infection rate.
Table 3. Prevalence of pathogens in questing D. marginatus, D. reticulatus, and H. inermis ticks.
Table 3. Prevalence of pathogens in questing D. marginatus, D. reticulatus, and H. inermis ticks.
Prevalence of Pathogens Detected in Questing D. marginatus (%)
Developmental StageTotal No. of
Examined Ticks
Infestation with Iph. hookeriPrevalence (%)Iph. hookeriWolbachia spp.Borreliella spp.Babesia spp./Theileria spp.Anaplasma spp.Bartonella spp.Rickettsia spp.
Male12NegativePrevalence (%) (no. of positive ticks)0000(n = 3) 25(n = 1) 8.33(n = 9) 75
Female700(n = 1) 14.29000(n = 4) 57.14
Nymph800(n = 1) 12.500(n = 1) 12.5(n = 1) 12.5
Larvae120000000
Total 39 Overall prevalence (%)00(n = 2) 5.130(n = 3) 7.69(n = 2) 5.13(n = 14) 35.9
Prevalence of Pathogens Detected in Questing D. reticulatus (%)
Male18Negative 0000(n = 3) 15.790(n = 10) 55.56
1Positive 1/1000001/1
Female31NegativePrevalence (%) (no. of positive ticks)000(n = 1) 3.22(n = 8) 25.810(n = 14) 45.16
Nymph7000000(n = 2) 28.6
Total no. of wasp-free ticks56Negative 000(n = 1) 1.79(n = 11) 19.640(n = 26) 46.43
Total 57 Overall prevalence (%)(n = 1) 1.7500(n = 1) 1.75(n = 11) 19.30(n = 27) 47.37
Prevalence of Pathogens Detected in Questing H. inermis (%)
Male55NegativePrevalence (%) (no. of positive ticks)0000(n = 7) 12.73(n = 2) 3.64(n = 25) 45.45
Female600000(n = 5) 8.33(n = 2) 3.33(n = 3) 5
Nymph90000(n = 1) 11.110(n = 9) 100
Total 124 Overall prevalence (%)0000(n = 13) 10.48(n = 4) 3.23(n = 37) 29.84
Table 4. Prevalence of pathogens in ticks from rodents.
Table 4. Prevalence of pathogens in ticks from rodents.
Prevalence of Pathogens in Different Tick Species from Rodents (%)
Tick SpeciesDevelopmental StageTotal no. of Examined TicksInfestation with Iph. hookeriPrevalence (%)Iph. hookeriWolbachia spp.Borreliella spp.Babesia spp./Theileria spp.Anaplasma spp.Bartonella spp.Rickettsia spp.
I. triangulicepsLarvae19Negative 000000(n = 1) 5.26
H. inermisLarvae2Negative 000 1/2000
D. marginarusLarvae92NegativePrevalence (%) (no. of positive ticks)00(n = 10) 10.8700(n = 8) 8.71(n = 10) 10.87
3Positive3/33/301/3000
95Total(n = 3) 3.16(n = 3) 3.16(n = 10) 10.53(n = 1) 1.10(n = 8) 8.42(n = 10) 10.53
D. reticulatusLarvae60Negative 00(n = 4) 6.67(n = 6) 100(n = 1) 1.67(n = 2) 3.33
12Positive (n = 12) 100(n = 11) 91.67(n = 1) 8.33(n = 1) 8.3300(n = 3) 25
72Total (n = 12) 16.67(n = 11) 15.27(n = 5) 6.94(n = 7) 9.720(n = 1) 1.39(n = 5) 6.94
Table 5. Nucleotide sequences obtained in this study, which were submitted to the GenBank database.
Table 5. Nucleotide sequences obtained in this study, which were submitted to the GenBank database.
HostOrganismGene FragmentAccession Number
I. ricinusIph. hookericox1PP079108-PP079110
I. ricinusIph. hookeri28S rRNAPP085018-PP085022
I. ricinusB. microti18S rRNAPP086648; PP086656
I. ricinusA. phagocytophilummsp2PP239200-202
I. ricinusBorreliella afzeliirrfA-rrlBPP230799
I. ricinusR. helveticagltAPP230811-PP230815
Rickettsia sp.gltAPP230816
B. bovisssrAPP230802-PP230805
Bartonella sp.ssrAPP230809
H. concinnaIph. hookericox1PP079105-PP079107
H. concinnaIph. hookeri28S rRNAPP084992-PP085001
H. concinnaB. canis18S rRNAPP086528; PP086530
H. concinnaBabesia sp. 2 (Eurasia)18S rRNAPP086565
H. concinnaTh. capreoli18S rRNAPP086524; PP086526; PP086532; PP086645-46; PP086675-76
H. concinnaBabesia sp. 18S rRNAPP213167
H. concinnaR. helveticagltAPP230818, PP230819
Rickettsia sp.gltAPP230817
D. marginatusIph. hookeri28S rRNAPP085019
B. grahamiissrAPP230800, PP230806-PP230808
D. reticulatusBartonella sp.ssrAPP230810
Table 6. Observed co-occurrence of Iph. hookeri and tick-borne pathogens in ticks.
Table 6. Observed co-occurrence of Iph. hookeri and tick-borne pathogens in ticks.
I. ricinusH. concinnaD. marginatusD. reticulatus
Observed Co-occurrence12216
Odds ratio2.120.660.921.46
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Blažeková, V.; Stanko, M.; Sprong, H.; Kohl, R.; Zubriková, D.; Vargová, L.; Bona, M.; Miklisová, D.; Víchová, B. Ixodiphagus hookeri (Hymenoptera: Encyrtidae) and Tick-Borne Pathogens in Ticks with Sympatric Occurrence (and Different Activities) in the Slovak Karst National Park (Slovakia), Central Europe. Pathogens 2024, 13, 385. https://doi.org/10.3390/pathogens13050385

AMA Style

Blažeková V, Stanko M, Sprong H, Kohl R, Zubriková D, Vargová L, Bona M, Miklisová D, Víchová B. Ixodiphagus hookeri (Hymenoptera: Encyrtidae) and Tick-Borne Pathogens in Ticks with Sympatric Occurrence (and Different Activities) in the Slovak Karst National Park (Slovakia), Central Europe. Pathogens. 2024; 13(5):385. https://doi.org/10.3390/pathogens13050385

Chicago/Turabian Style

Blažeková, Veronika, Michal Stanko, Hein Sprong, Robert Kohl, Dana Zubriková, Lucia Vargová, Martin Bona, Dana Miklisová, and Bronislava Víchová. 2024. "Ixodiphagus hookeri (Hymenoptera: Encyrtidae) and Tick-Borne Pathogens in Ticks with Sympatric Occurrence (and Different Activities) in the Slovak Karst National Park (Slovakia), Central Europe" Pathogens 13, no. 5: 385. https://doi.org/10.3390/pathogens13050385

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop