Profile of Enterobacteria Resistant to Beta-Lactams
Abstract
:1. Introduction
2. Results
3. Discussion
4. Methods
5. Conclusions
Author Contributions
Funding
Conflicts of Interest
References
- Mlaga, K.D.; Lotte, R.; Montaudié, H.; Rolain, J.-M.; Ruimy, R. ‘Nissabacter archeti’ gen. nov., sp. nov., a new member of Enterobacteriaceae family, isolated from human sample at Archet 2 Hospital, Nice, France. New Microbes New Infect. 2017, 17, 81–83. [Google Scholar] [CrossRef] [PubMed]
- Winn, W.C.; Allen, S.D.; Janda, W.M.; Koneman, S. Diagnóstico Microbiológico: Texto e Atlas colorido. Guanab. Koogan. 2008, 16, 1–1760. [Google Scholar]
- Coque, T.; Baqueiro, F.; Canton, R. Increasing prevalence of ESBL- producing Enterobacteriaceae in Europe. Eurosurveillance 2008, 13, 1–11. [Google Scholar]
- Lutgring, J.D.; Limbagob, B.M. The Problem of Carbapenemase-Producing-Carbapenem-Resistant Enterobacteriaceae Detection. J. Clin. Microbiol. 2016, 54, 529–534. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Vega, S.; Dowzicky, M.J. Antimicrobial susceptibility among Gram-positive and Gram-negative organisms collected from the Latin American region between 2004 and 2015 as part of the Tigecycline Evaluation and Surveillance Trial. Ann. Clin. Microbiol. Antimicrob. 2017, 16, 1–16. [Google Scholar] [CrossRef]
- Ozsurekci, Y.; Aykac, K.; Cengiz, A.B.; TanırBasaranoglu, S.; Sancak, B.; Karahan, S.; Kara, A.; Ceyhan, M. Bloodstream infections in children caused by carbapenem-resistant versus carbapenem-susceptible gram-negative microorganisms: Risk factors and outcome. Diagn. Microbiol. Infect. Dis. 2017, 87, 359–364. [Google Scholar] [CrossRef]
- Prestinaci, F.; Pezzotti, P.; Pantosti, A. Antimicrobial resistance: A global multifaceted phenomenon. Pathog. Glob. Health 2015, 109, 309–318. [Google Scholar] [CrossRef] [Green Version]
- Tang, L.K.; Caffrey, P.N.; Nóbrega, B.D.; Cork, C.S.; Ronksley, E.P.; Barkema, W.H.; Polachek, J.A.; Ganshorn, H.; Sharma, N.; Kellner, D.J.; et al. Restricting the use of antibiotics in food-producing animals and its associations with antibiotic resistance in food-producing animals and human beings: A systematic review and meta-analysis. Lancet Planet. Health 2017, 1, 316–327. [Google Scholar] [CrossRef]
- Bougnom, P.B.; Piddock, J.L. Wastewater for urban agriculture. A significant factor in dissemination of antibiotic resistance. Environ. Sci. Technol. 2017, 51, 5863–5864. [Google Scholar] [CrossRef] [Green Version]
- EFSA (European Food Safety Authority) and ECDC (European Centre for Disease Prevention and Control). The European Union summary report on antimicrobial resistance in zoonotic and indicator bacteria from humans, animals and food in 2017. EFSA J. 2019, 17, 278. [Google Scholar] [CrossRef]
- Rossoline, G.M.; Arena, F.; Pecile, P.; Pollini, S. Update on the antibiotic resistance crisis. Curr. Opin. Pharmacol. 2014, 18, 56–60. [Google Scholar] [CrossRef] [PubMed]
- Magiorakos, A.-P.; Srinivasan, A.; Carey, R.; Carmeli, Y.; Falagas, M.E.; Giske, C.; Harbarth, S.; Hindler, J.; Kahlmeter, G.; Olsson-Liljequist, B.; et al. Bacteria: An International Expert Proposal for Interim Standard Definitions for Acquired Resistance. Microbiology 2011, 18, 268–281. [Google Scholar]
- Levy, S.B.; Marshall, B. Antibacterial resistance worldwide: Causes, challenges and responses. Nat. Med. Suppl. 2004, 10, 122–129. [Google Scholar] [CrossRef] [PubMed]
- Koraimann, G. Spread and Persistence of Virulence and Antibiotic Resistance Genes: A Ride on the F Plasmid Conjugation Module. EcoSal Plus 2018, 8, 1–23. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Chant, C.; Leung, A.; Friedrich, J.O. Optimal dosing of antibiotics in critically ill patients by using continuous/extended infusions: A systematic review and metaanalysis. Crit. Care 2013, 17, R279. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Martínez-Martínez, L.; Gonzáles-López, J.J. Carbapenemases in Enterobacteriaceae: Types and molecular epidemiology. Enferm. Infecc. y Microbiol. Clin. 2014, 32, 4–9. [Google Scholar] [CrossRef]
- Bertoncheli, C.D.M.; Hörner, R. Uma revisão sobre metalo-β-lactamases. Rev. Bras. de Ciências Farm. 2008, 44, 577–599. [Google Scholar] [CrossRef] [Green Version]
- Lekshmi, P.N.C.J.; Sumi, B.; Viveka, S.; Jeeva, S.; Brindha, R. Antibacterial activity of nanoparticles from Allium sp. J. Microbiol. Biotechnol. Res. 2012, 2, 115–119. [Google Scholar]
- Balouiri, M.S.; Moulay, I.; Saad, K. Methods for in vitro evaluating antimicrobial activity: A review. J. Pharm. Anal. 2016, 6, 71–79. [Google Scholar] [CrossRef] [Green Version]
- Tuite, N.; Reddington, K.; Barry, T.; Zumla, A.; Enne, V. Rapid nucleic acid diagnostics for the detection of antimicrobial resistance in Gram-negative bacteria: Is it time for a paradigm shift. J. Antimicrob. Chemother. 2014, 69, 1729–1733. [Google Scholar] [CrossRef]
- Jabur, A.P.L.; Magalhães, L.G.; Borges, A.A.; Cardoso, A.L. Infecção urinária em gestantes atendidas em um laboratório de análises clínicas de Goiânia-GO ente 2012 e 2013. Estudos 2014, 41, 637–641. [Google Scholar]
- Agência Nacional de Vigilância Sanitária. Boletim de Segurança do Paciente e Qualidade em Serviços de Saúde nº 16 (Corrigido). 2017. Available online: https://www20.anvisa.gov.br/segurancadopaciente/index.php/publicacoes/item/boletim-seguranca-do-paciente-e-qualidade-em-servicos-de-saude-n-16-avaliacao-dos-indicadores-nacionais-das-infeccoes-relacionadas-a-assistencia-a-saude-iras-e-resistencia-microbiana-do-ano-de-2016 (accessed on 19 September 2018).
- Logan, L.K.; Weinstein, R.A. The Epidemiology of Carbapenem-Resistant Enterobacteriaceae: The Impact and Evolution of a Global Menace. J. Infect. Dis. 2017, 215, S28–S36. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Secchyna, F.; Gaur, R.; Sandlund, J.; Truong, C.; Tremintin, G.; Küeltz, D.; Gomez, C.; Tamburini, F.B.; Andermann, T.M.; Bhatt, A.; et al. Diverse Mechanisms of Resistance in Carbapenem-Resistant Enterobacteriaceae at a Health Care System in Silicon Valley, California. BioRxiv 2018. [Google Scholar] [CrossRef]
- Neto, M.A.R.; Rios, V.M.; Corá, L.F.; Fonseca, M.M.; Ferreira-Paim, K.; Fonseca, F.M. High rates of antimicrobial resistance of ESBL-producing Enterobacteriaceae isolated from clinical samples in Northeast of Brazil. Infect. Dis. 2018, 50, 229–231. [Google Scholar] [CrossRef] [PubMed]
- Agência Nacional de Vigilância Sanitária. Nota Técnica Nº 01/2013:Medidas de Prevenção e Controle de Infecções por Enterobactérias Multiresistentes; Agência Nacional de Vigilância Sanitária: Brasília, Brazil, 2013. [Google Scholar]
- Wendel, A.F.; Brodner, A.H.B.; Wydra, S.; Ressina, S.; Henrich, B.; Pfeffer, K.; Toleman, M.A.; MacKenziea, C.R. Genetic Characterization and Emergence of the Metallo- β-Lactamase GIM-1 in Pseudomonas spp. and Enterobacteriaceae during a Long-Term Outbreak. Antimicrob. Agents Chemother. 2013, 57, 5162–5165. [Google Scholar] [CrossRef] [Green Version]
- Pfeifer, Y.; Cullik, A.; Witte, W. Resistance to cephalosporins and carbapenems in Gram-negative bacterial pathogens. Int. J. Med Microbiol. 2010, 300, 371–379. [Google Scholar] [CrossRef]
- Verdet, C.; Benzerara, Y.; Gautier, V.; Adam, O.; Ould-Hocine, Z.; Arlet, G. Emergence of DHA-1-Producing Klebsiella spp. in the Parisian Region: Genetic Organization of the ampC and ampR Genes Originating from Morganella morganii. Antimicrob. Agents Chemother. 2006, 50, 607–617. [Google Scholar] [CrossRef] [Green Version]
- Kjeldsen, T.S.B.; Overgaard, M.; Nielsen, S.S.; Bortolaia, V.; Jelsbak, L.; Sommer, M.; Guardabassi, L.; Olsen, J.E. CTX-M-1 β-lactamase expression in Escherichia coli is dependent on cefotaxime concentration, growth phase and gene location. J. Antimicrob. Chemother. 2015, 70, 62–70. [Google Scholar] [CrossRef] [Green Version]
- Warjri, I.; Dutta, T.K.; Lalzampuia, H.; Chandra, R. Detection and characterization of extended-spectrum β-lactamases (blaCTX-M-1 and blaSHV) producing Escherichia coli, Salmonella spp. and Klebsiella pneumoniae isolated from humans in Mizoram. Vet. World 2015, 8, 599–604. [Google Scholar] [CrossRef] [Green Version]
- Machuca, J.; Agüerob, J.; Mirób, E.; Conejob, M.C.; Oteob, J.; Boub, G.; González-Lópezb, J.J.; Oliverb, A.; Navarrob, F.; Pascuala, A.; et al. Prevalencia en España de mecanismos de resistencia a quinolonas enenterobacterias productoras de betalactamasas de clase C adquiridasy/o carbapenemasas. Enferm. Infecc. y Microbiol. Clínica 2017, 35, 487–492. [Google Scholar] [CrossRef]
- Pietscha, M.; Eller, C.; Wendtc, C.; Holfelderc, M.; Falgenhauerd, L.; Fruthe, A.; Grössla, T.; Leistnerf, R.; Valenzag, G.; Wernera, G.; et al. Molecular characterisation of extended-spectrum β-lactamase (ESBL)-producing Escherichia coli isolates from hospital and ambulatory patients in Germany. Vet. Microbiol. 2017, 200, 130–137. [Google Scholar] [CrossRef] [PubMed]
- Wang, L.; Liu, P.; Wei, D.; Liu, Y.; Wan, L.; ** Gene Sequencing. Can. J. Infect. Dis. Med. Microbiol. 2016, 1, 1–4. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Marques, J.B.; Bonez, P.C.; Agertt, V.A.; Flores, V.C.; Dalmolin, T.V.; Rossi, G.G.; Forno, N.L.F.D.; Bianchini, B.V.; Mizdal, C.R.; Siqueira, F.S.; et al. Molecular characterization of Enterobacteriaceae resistant to carbapenem antimicrobials. Rev. Bras. de Patol. Médica Lab. 2015, 51, 162–165. [Google Scholar] [CrossRef]
- Kralik, P.; Ricchi, M. A basic guide to real time PCR in microbial diagnostics: Definitions, parameters, and everything. Front. Microbiol. 2017, 8, 1–9. [Google Scholar] [CrossRef] [Green Version]
- Stefaniak, L.A.; Duarte, E.L.; Nishiyama, S.A.B.; Nakano, V. Resistência bacteriana: A importância das beta-lactamases. Rev. UNINGÁ 2005, 4, 123–137. [Google Scholar]
- Álvarez, L.M.A.; García, J.M.G.; Hernández, M.D.P.; González, S.M.; Gutiérrez, J.J.P. Utility of Phenotypic and Genotypic Testing in the Study of Mycobacterium tuberculosis Resistance to First-Line Anti-Tuberculosis drugs. Arch. Broncopneumol. 2017, 53, 192–198. [Google Scholar] [CrossRef]
- Filho, D.B.F.; Rocha, E.C.; Júnior, J.A.S.; Paranhos, R.; Neves, J.A.B.; Silva, M.B. Desvendando os Mistérios do Coeficiente de Correlação de Pearson: O retorno. Leviathan-Cad. Pesqui. Políica 2014, 8, 66–96. [Google Scholar]
- Rodrigues, R.L.; Nascimento, H.F.; Menezes, G.L.; Lopes, A.R.; Nevoa, J.C.; Soares, W.C.S.; Santiago, S.B.; Barbosa, M.S. Contribuição ao estudo comparativo do diagnóstico laboratorial clássico e molecular de Helicobacter pylori: Uma abordagem investigativa. Rev. Acadêmica do Inst. de Ciências da Saúde 2016, 2, 18–25. [Google Scholar]
- Jarlier, V.; Nicolas, M.H.; Fournier, G.; Philippon, A. Extended broad-spectrum β-lactamases conferring transferable resistance to newer β-lactam agents in Enterobacteriaceae: Hospital prevalence and susceptibility patterns. Rev. Infect. Dis. 1988, 10, 867–878. [Google Scholar] [CrossRef] [PubMed]
- Brazilian Committee on Antimicrobial Suscetibility Testing. Orientações do EUCAST para Detecção de Mecanismos de Resistência e Resistências Específicas de Importância Clinica e/ou Epidemiológica. 2015. EUCAST. Versão 1.0. Available online: http://brcast.org.br/documentos (accessed on 16 February 2018).
- Clinical and Laboratory Standards Institute. Performance Standards for Antimicrobial Susceptibility Testing-Informational Supplement M100-S22; Versão 27; CLSI: Wayne, PA, USA, 2017. [Google Scholar]
Antibiotics | Percentage of Antimicrobial Resistance (%) | |||||
---|---|---|---|---|---|---|
Manual Resuscitators | Human Cornea | Human Tonsilas | Veterinary Hospital | Animal Bladder | Animal Uterus | |
Ampicillin | 42.85 | 65.21 | 0.2 | 90.47 | 100 | 100 |
Aztreonam | 0 | 26.08 | 0 | 85.71 | 0 | 0 |
Amoxicillin-clavalunate | 0 | 39.13 | 0 | 90.47 | 100 | 100 |
Ceftazidime | 100 | 30.43 | 0 | 85.71 | 100 | 0 |
Cefoxitin | 42.85 | 39.13 | 0.2 | 76.19 | 0 | 0 |
Cefazolin | 0 | 52.17 | 100 | 80.95 | 100 | 0 |
Cefepime | 100 | 30.43 | 0 | 95.23 | 0 | 0 |
Ceftriaxone | 0 | 26.08 | 0 | 0 | 0 | 0 |
Cefuroxime | 100 | 26.08 | 0 | 76.19 | 0 | 0 |
Imipenem | 100 | 30.43 | 0.2 | 28.57 | 100 | 0 |
Piperacillin-tazobactam | 100 | 17.39 | 0 | 67.66 | 100 | 0 |
Antimicrobials | Molecular Detection Rate (%) | Phenotypic Detection Rate (%) | Descriptive Statistics | ||
---|---|---|---|---|---|
Standard Deviation | Default Error | Variance | |||
Ampicillin | 83.33 | 74.28 | 6.39931637 | 4.525 | 40.95125 |
Aztreonam | 94.44 | 34.28 | 42.53954396 | 30.08 | 1809.6128 |
Amoxicilina + Clavalunate | 88.88 | 62.85 | 18.40599 | 13.015 | 338.7805 |
Ceftazidime | 94.44 | 51.42 | 30.41973 | 21.51 | 925.3602 |
Cefoxitine | 94.44 | 41.42 | 37.4908 | 26.51 | 1405.56 |
Cefazoline | 38.88 | 54.28 | 10.88944 | 7.7 | 118.58 |
Cefepime | 88.88 | 44.28 | 31.53696 | 22.3 | 994.58 |
Ceftriaxone | 88.88 | 41.42 | 33.55929 | 23.73 | 1126.226 |
Cefuroxime | 72.22 | 8.57 | 45.00735 | 31.825 | 2025.661 |
Imipenem | 88.88 | 35.71 | 37.59687 | 26.585 | 1413.524 |
Piperacillin + Tazobactam | 94.44 | 41.42 | 37.4908 | 26.51 | 1405.56 |
Antibiotics | blaOXA | blaIMP | blaNDM | blaSME | blaDHA | blaCMY | blaTEM | blaKPC | blaSPM | blaCTX-M | blaVIM | blaSIM | blaGIM | blaSHV |
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Ampicillin | + | - | - | + | - | + | + | + | + | + | - | + | - | + |
Aztreonam | + | + | + | - | + | + | + | + | + | + | + | + | - | + |
Amoxicillin + Clavanulate | + | + | + | - | - | + | + | + | - | + | + | - | - | + |
Ceftazidime | + | + | + | - | + | + | + | + | + | + | + | + | - | + |
Cefoxitin | + | - | + | - | + | + | + | + | + | + | - | - | - | + |
Cefazolin | + | + | + | - | + | + | + | + | - | + | - | - | - | + |
Cefepime | + | + | + | - | + | + | + | + | + | + | + | + | - | + |
Ceftriaxone | + | + | + | - | + | + | + | + | - | + | - | - | - | + |
Cefuroxime | + | - | + | - | - | - | + | + | + | + | + | - | - | + |
Imipenem | + | + | + | + | + | + | + | + | + | + | + | + | + | + |
Piperacillin + Tazobactam | + | + | + | - | - | + | + | + | + | + | + | + | - | + |
Bacterial Genus | Number of Samples |
---|---|
Cedecea neteri | 2 |
Citrobacter freundii | 3 |
Edwardsiella ictaluri | 1 |
Enterobacter aerogenes | 12 |
Enterobacter agglomerans | 6 |
Erwinia persicina | 1 |
Escherichia blattae | 1 |
Escherichia coli | 12 |
Hafnia alvei | 3 |
Klebsiella spp. | 7 |
Morganella morganii | 2 |
Proteus mirabilis | 4 |
Providencia rustigiani | 1 |
Providencia spp. | 1 |
Raoultella terrigena | 1 |
Salmonella paratyphia | 1 |
Salmonella spp. | 2 |
Salmonella typhi | 2 |
Serratia marcecens | 6 |
Yersinia ruckeri | 1 |
Yersinia spp. | 1 |
Genes | Gene Sequence from 5′ to 3′ | Temperature of Ringing | Quantity of Bases | Access at the GenBank | Amplified Fragment Size |
---|---|---|---|---|---|
blaOXA | Sense: GGCAGCGGGTTCCCTTGTC | 49.7 | 19 | FN396876.1 | 171pb |
Reverso: CGATAATGGGCTGCAGCGG | 49.7 | 19 | |||
blaIMP | Sense: CCAGCGTACGGCCCACAGA | 49.6 | 19 | NG035455.1 | 138pb |
Reverso: GGTGATGGCTGTTGCGGCA | 50.3 | 19 | |||
blaNDM | Sense: CGGCCGCGTGCTGGTG | 49.8 | 16 | JN711113.1 | 182pb |
Reverso: GGCATAAGTCGCAATCCCCG | 50.2 | 20 | |||
blaSME | Sense: GGCGGCTGCTGTTTTAGAGAGG | 50.9 | 25 | KJ188748.1 | 184pb |
Reverso: TGCAGCAGAAGCCATATCACCTAAT | 50.3 | 22 | |||
blaDHA | Sense: GCGGGCGAATTGCTGCAT | 49.8 | 18 | NG041043.1 | 183pb |
Reverso: TGGGTGCCGGGGTAGCG | 50.1 | 17 | |||
blaCMY | Sense: GGATTAGGCTGGGAGATGCTGAA | 50.1 | 23 | NG041279.1 | 158pb |
Reverso: CCAGTGGAGCCCGTTTTATGC | 49.6 | 21 | |||
blaTEM | Sense: TCCGTGTCGCCCTTATTCCC | 49.6 | 20 | KJ923009 | 165pb |
Reverso: CCTTGAGAGTTTTCGCCCCG | 49.6 | 20 | |||
blaSHV | Sense: GGCAGCGGGTTCCCTTGTC | 49.7 | 19 | FN396876.1 | 171pb |
Reverso: CGATAATGGGCTGCAGCGG | 49.7 | 19 | |||
blaVIM | Sense: GTTATGCCGCACCCACCCC | 50.3 | 19 | NG036099.1 | 194 pb |
Reverso: ACCAAACACCATCGGCAATCTG | 49.7 | 22 | |||
blaSPM | Sense: CGAAAATGCTTGATGGGACCG | 50.3 | 21 | DQ145284.1 | 147pb |
Reverso: CACCCGTGCCGTCCAAATG | 49.7 | 19 | |||
blaCTX | Sense: CTGAGCTTAGCGCGGCCG | 50.1 | 18 | FJ815279.1 | 189pb |
Reverso: AATGGCGGTGTTTAACGTCGG | 50.0 | 21 | |||
blaGIM | Sense: CGGTGGTAACGGCGCAGTG | 50.2 | 19 | JX566711.1 | 149pb |
Reverso: TGCCCTGCTGCGTAACATCG | 50.2 | 20 | |||
blaKPC | Sense: GGCGGCTCCATCGGTGTG | 49.5 | 18 | AF297554.1 | 155pb |
Reverso: GTGTCCAGCAAGCCGGCCT | 50.4 | 19 | |||
blaSIM | Sense: GCACCACCGGCAAGCGC | 50.8 | 17 | EF125010.1 | 156pb |
Reverso: TGTCCTGGCTGGCGAACGA | 50.0 | 19 |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Santos, A.L.; dos Santos, A.P.; Ito, C.R.M.; Queiroz, P.H.P.d.; de Almeida, J.A.; de Carvalho Júnior, M.A.B.; de Oliveira, C.Z.; Avelino, M.A.G.; Wastowski, I.J.; Gomes, G.P.L.A.; et al. Profile of Enterobacteria Resistant to Beta-Lactams. Antibiotics 2020, 9, 410. https://doi.org/10.3390/antibiotics9070410
Santos AL, dos Santos AP, Ito CRM, Queiroz PHPd, de Almeida JA, de Carvalho Júnior MAB, de Oliveira CZ, Avelino MAG, Wastowski IJ, Gomes GPLA, et al. Profile of Enterobacteria Resistant to Beta-Lactams. Antibiotics. 2020; 9(7):410. https://doi.org/10.3390/antibiotics9070410
Chicago/Turabian StyleSantos, Andressa Liberal, Adailton Pereira dos Santos, Célia Regina Malveste Ito, Pedro Henrique Pereira de Queiroz, Juliana Afonso de Almeida, Marcos Antonio Batista de Carvalho Júnior, Camila Zanatta de Oliveira, Melissa Ameloti G. Avelino, Isabela Jubé Wastowski, Giselle Pinheiro Lima Aires Gomes, and et al. 2020. "Profile of Enterobacteria Resistant to Beta-Lactams" Antibiotics 9, no. 7: 410. https://doi.org/10.3390/antibiotics9070410