Case of Vibrio vulnificus Infection in Orechromis niloticus during Suspension of Recirculating Aquaculture System

Abstract

During a suspension of a GIFT tilapia broodstock recirculating aquaculture system (RAS), a significant fish mortality event occurred. To determine the cause, four bacterial strains were isolated from affected fish and identified as Vibrio vulnificus through 16S rDNA sequencing. Virulence assays confirmed the pathogenicity of these strains, with the most virulent, CS-4, selected for a further analysis. Antimicrobial testing revealed CS-4’s sensitivity to 19 antibiotics, including meloxicillin and Gentamicin. Challenge tests indicated varied 7-day Lethal Dose 50 (LD₅₀) values for CS-4 depending on the infection route, with immersion after skin injury being the most lethal. Additionally, the effects of salinity, crowding with air exposure, and nitrite on tilapia mortality were evaluated. The results showed that salinity stress increased the mortality rate of tilapia infected with V. vulnificus through immersion, and that salinity stress and V. vulnificus infection had a synergistic effect. A 20 min crowding with air exposure stress reduced the mortality rate of Nile tilapia infected with V. vulnificus. Nitrite stress had little effect on the mortality rate of tilapia infected with V. vulnificus. The results of the risk factor analysis indicated that salinity was the main factor affecting tilapia mortality caused by V. vulnificus infection. This study will serve as a valuable reference for the future management of similar RAS.

1. Introduction

Fisheries contribute nearly one-fifth of the world’s source of edible, high-quality animal protein. With the decline in natural fishery resources since the last century, the continuous improvement in aquaculture production has been crucial in ensuring a steady global supply of aquatic products [1]. However, in aquaculture, a significant portion of the feed given to farmed animals is not converted into marketable products, as only a small fraction of it is utilized by the animals. The majority of the feed is released into the water as residual bait, feces, and metabolic byproducts. The direct discharge of these aquaculture effluents poses substantial environmental pollution risks [2].

Recirculating aquaculture systems (RASs) offer an innovative method of fish farming that diverges from conventional outdoor techniques. These systems facilitate the cultivation of fish in indoor tanks with meticulously regulated environments. RAS removes excess nutrients in water through facilities, equipment, biological treatment, and other measures [1,3]. However, under extreme conditions (such as power outages due to severe typhoons or destructive storms) and after long-term operation, the temporary suspension of RAS facilities is unavoidable, either proactively or passively. The suspension of the system, or even a part of it, presents various health management challenges to the farmed fish. This is attributed to the intrinsic correlation between fish health and water quality within the sophisticated RAS [4]. Despite a multitude of studies on RAS in recent years, the focus has predominantly been on aspects of water treatment and system optimization. These include advancements in physical filtration, nitrogen removal processes, and the implementation of automated control technologies [3,4,5]. Therefore, it is of great need to study the types and possible causes of disease outbreaks during/after circulation system suspension.

Nile tilapia (Oreochromis niloticus), particularly the Genetically Improved Farmed Tilapia (GIFT), has become one of the most important cultured fish species in the world due to its excellent production performance and economic value [6]. Many studies have shown that tilapia aquaculture is affected by bacterial, parasitic, and viral diseases, among which bacterial diseases have been widely reported [7,8,9]. Nevertheless, these studies primarily focus on the isolation and identification of pathogens and their pathogenic characteristics, giving less importance to establish correlations between possible risk factors and the outbreaks of the pathogen [8,9]. The potential risk factors were divided into two progressive and related sections: (a) external stressors, including environmental variables, fish density, water quality, pathogens, etc.; and (b) management factors, including the mechanical transmission process and inadequate technical training [9].

Broodstock cultivation and management is critical in ensuring a stable and reliable fry supply. This is essential for the development of the tilapia industry. Utilizing RAS for tilapia broodstock rearing and management can effectively mitigate the impact of natural conditions on fry production, thereby facilitating a more stable fry breeding [10]. Furthermore, RAS implementation contributes to reduced environmental pollution from farming effluents. When conducting GIFT tilapia farming, the sludges accumulated during the farming process were cleared and disinfected after each farming cycle to benefit production in the next cycle. Similarly, the long-term operation of RAS in broodstock rearing can also result in the accumulation of sludge. As sludge accumulates over time, it can clog filters, reduce the effective volume of tanks, and decrease the overall performance of the treatment processes, making it essential to regularly clean and maintain water treatment systems to ensure their efficiency [11]. But unlike regular tilapia production, in which sludge clearing poses no threat to fish health since fish are already harvested at the time, the rearing of tilapia broodstock is continuous. Suspending the water treatment system during cleaning or maintenance poses potential risks, including compromised production management, deterioration of water quality, and subsequent disease outbreaks in tilapia broodstock.

In this study, we investigated a case of Vibriosis in tilapia broodstock reared in an onshore RAS during a suspension of the water treatment system. Our aim was to illustrate how the suspension of water circulation in the RAS, combined with slight changes in certain parameters in water quality, can increase the virulence of a potential pathogen and impact the health of farmed fish. This study will provide reference data for future operation in similar RAS.

2. Materials and Methods

All the animal experimental procedures in this study were approved by the Hainan University Animal Use and Care Committee (No. HNUAUCC-2021-00088).

2.1. History of the Case

The location represented in Figure 1, situated near the estuary at the mouth of Maniao River in Hainan, China (latitude: 19°9′ N; longitude: 109°85′ E), operates a stable recirculating aquaculture system with water salinity maintained at ≤1.0 g/L, which includes a sewage treatment pond and an encircling channel (as depicted in Figure 2). Typically, the valve that connects the farm to the Maniao River remains closed to maintain the system’s integrity (Figure 2A). However, due to the necessity of desilting the channel and cleaning the water pipes, the recirculating water system was temporarily halted (Figure 2B). Consequently, the tilapia broodstock had to be relocated to a nearby pond. Before the relocation of broodstock, one-third of the water in the broodstock ponds was discharged, and the fish were gathered. Then, the fish were put into new ponds filled with water pumped from Maniao River, which, influenced by high tide, had a higher salinity of 6 g/L and an elevated nitrite content. During this transition, the tilapia were briefly anesthetized and exposed to air. A small number of fish (about 5% of the broodstock population) died one day post translocation. By the third day, a substantial die-off occurred among the tilapia broodstock, with the cumulative mortality rate exceeding 30%. The moribund fish floated on the water surface, barely moving.

2.2. Fish

The moribund tilapia (n = 3; length: 40–45 cm) from the tilapia broodstock breeding farm were caught by a net, stored on ice, and immediately shipped to a laboratory in Hainan University for pathologic diagnoses and pathogen isolation.

Healthy tilapia (GIFT) (n = 1200; weighing 10.5 ± 4.3 g) with no history of disease were provided by a local fish supplier. They were used for a bacterial virulence test, challenge experiments, LD50 evaluation, and risk factor experiments. Prior to the assays, fish were acclimatized in an aquarium with aeration for two weeks in Hainan University, China. In the follow-up experiments, the water quality of experimental fish was maintained at a temperature of 28 ± 1 °C, pH 7.0 ± 0.08, and dissolved oxygen >6 mg/L. The water was replaced daily, with a 14 h:10 h light/dark cycle. The experimental fish were offered commercial feed (Guangdong Feng Hua Food. Co., Ltd., Guangzhou, China) at 4% body weight once a day.

2.3. Water Quality Evaluation

Broodstock pond water quality was monitored as part of the regular management measures. Salinity was measured using a Salinity Refractometer; ammonia nitrogen, nitrate nitrogen, nitrite nitrogen, total nitrogen, total phosphorus, orthophosphate, chemical oxygen demand, and suspended solids were measured using a HACH^® DR900 Multiparameter Portable Colorimeter (Hach Company, Loveland, CO, USA).

2.4. Pathologic Diagnosis

2.4.1. External and Anatomical Observation

The external appearance, as well as the oral and nasal cavities and gills, were examined visually or with the aid of a magnifying glass. Afterwards, the fish samples were dissected to observed their anatomical characteristics.

2.4.2. Histopathology

The liver, spleen, and intestine of moribund tilapia (GIFT) with typical symptoms (such as signs of hemorrhaging/ulcers/congestion on fish surface) were fixed in a paraformaldehyde (4%) solution, dehydrated in ethanol, embedded in paraffin wax blocks, sectioned at 6 μm, and stained with H&E for observation by light microscopy [12].

2.5. Bacterial Isolation and Identification

2.5.1. Bacterial Isolation

For bacterial isolation, the liver, spleen, kidney, and brain of the moribund tilapia were collected using sterilized tools and streaked on Luria–Bertani (LB) agar plates supplemented with 1% (w/v) NaCl and incubated at 28 °C for 24 h. Then, single colonies of dominant bacteria were randomly picked and streaked on LB agar plates and incubated in the same condition. This procedure was repeated at least 3 times to obtain a pure culture. Afterwards, single colonies of dominant bacteria were identified by light microscopy observation, biochemical characteristics, and molecular tools. All obtained isolates were stored in 50% (v/v) glycerol at −80 °C.

2.5.2. Virulence Test

Bacterial virulence of the obtained isolates was examined by a challenge trial. Healthy tilapia (GIFT) (n = 50) were randomly divided into 5 groups (4 treatment groups and 1 control group), each with 10 fish. The obtained isolates were grown overnight in 100 mL LB broth at 28 °C. The bacterial suspensions were harvested by centrifugation (3000 rpm, 15 min), washed, and resuspended in phosphate-buffered saline (PBS) to an OD value (at 600 nm) of approximately 1.0 (about 5.0 × 10⁸ CFU/mL). Each treatment group was intraperitoneally injected (i.p.) (0.1 mL/fish) with one of the obtained isolates and the control group was i.p.-injected with 0.1 mL of sterile PBS per fish. Fish mortality was observed at 12 hours (h), 24 h, and 48 h post injection. To satisfy Koch’s postulate, the bacteria were re-isolated and identified from the kidneys, brains, spleens, and livers of the moribund fish. The most virulent strain was chosen as a representative for subsequent experiments.

2.5.3. Bacterial Identification

1.

Physiological and biochemical tests

The preliminary characterization of the isolated strains was carried out by Gram staining, and the morphological characteristics of the colonies were observed. The biochemical characteristics were determined using microbial biochemical identification tubes (Qingdao Hope Bio-Technology Co., Ltd., Qingdao, China) with reference to Bergey’s Manual of Systematic Bacteriology.

2.

Molecular identification

Bacterial DNA was extracted using the MiniBEST Bacteria Genomic DNA Extraction Kit (TaKaRa, Dalian, China) following the manufacturer’s instructions. The primers used for the PCR amplification of 16S rRNA are listed in

Table 1. Pri3.4. Analysis and Influence of Risk Factorsd DNA fragment.

Gene	Primer Sequences (5′-3′)	Expected Size/bp	Annealing Tm (°C)	Reference
16S rRNA	27F: AGAGTTTGATCATGGCTCAG	1504	55	[13]
	1492R: GGTTACCTTGTTACGACTT

. All primers were synthesized commercially by the Bei**g Genomics Institute, Bei**g, China.

The BLAST was performed at the National Center for Biotechnology Information (NCBI, https://www.nibi.nlm.nih.gov (accessed on 20 January 2022)). Phylogenetic trees were constructed using the neighbor-joining (N-J) algorithm (MEGA 7.0 software).

2.5.4. Antimicrobial Susceptibility Test

Twenty-four antibiotics (Penicillin, Mezlocillin, Cefradine, Cefotaxime, Gentamicin, Kanamycin, Streptomycin, Tobramycin, Neomycin, Tetracycline, Nalidixic acid, Aboren, Lincomycin, Vancomycin, Polymyxin B, Cotrimoxazole, Amoxicillin, Rifampicin, Trimethoprim, Enrofloxacin, Bacitracin, Florfenicol, Cefamandole, Doxycycline, Norfloxacin) were purchased from Hangzhou Microbial Reagent Co., Ltd., Hangzhou, China, and used to determine the susceptibility of isolated bacteria according to the British Society for Antimicrobial Chemotherapy (BSAC) standardized disc susceptibility testing method. After incubation at 28 °C for 24 h, the diameters of the inhibition zones of different antibiotics on LB agar plates were measured to determine the antimicrobial susceptibility (S), medium susceptibility (I), or resistance (R) of isolated bacteria. The reference strain, E. coli ATCC 25922, was used as the quality control.

2.5.5. Challenge Experiments and LD50

CS-4 was sub-cultured in 200 mL LB broth and was incubated at 28 °C for 12 h. Next, it was centrifuged at 3000 rpm for 15 min. After discarding the supernatant, the bacterial pellet was washed with PBS 3 times, and the CS-4 strain was diluted 10-fold with PBS to adjust to the desired concentration.

To explore the efficiencies of different infection routes of CS-4 into tilapia, four challenge experiments were conducted: intraperitoneal injection (i.p.), intramuscular injection (i.m.), immersion with epidermal injury (imm-i.), and immersion with no epidermal injury (imm-n.i.). Epidermal injury was induced by removal of a few scales on the fish back and making a cut on skin.

For the immersion challenge experiments, fish were first immersed in a diluted bacterial suspension of a certain concentration (1.0 × 10¹, 1.0 × 10², 1.0 × 10³, 1.0 × 10⁴, 1.0 × 10⁵, 1.0 × 10⁶, 1.0 × 10⁷, or 1.0 × 10⁸ CFU/mL) for 20 min. Then, fish were returned to fresh water. The control group was soaked in fresh water all the time.

For the injection challenge experiments, each fish was injected intraperitoneally or intramuscularly with a 0.1 mL bacterial suspension of a certain bacterial concentration (1.0 × 10¹, 1.0 × 10², 1.0 × 10³, 1.0 × 10⁴, 1.0 × 10⁵, 1.0 × 10⁶, 1.0 × 10⁷, or 1.0 × 10⁸ CFU/mL), whereas fish in the control group were inoculated with 0.1 mL of sterile PBS per fish.

For all above-mentioned challenge experiments, the water temperature was set to 28 °C. Each experimental group contains 2 parallels and each parallel has 10 fish. Therefore, a total of 720 fish (10 fish/parallel × 2 parallels/concentration × 9 concentrations/treatment × 4 treatments = 720 fish) were used for this experiment. Fish mortality of all treatment groups was recorded every 24 h interval for 7 days. LD₅₀ was calculated using the improved Karber’s method [14].

2.6. Analysis and Influence of Risk Factors

Through a literature review and analysis of production management operations and changes in pond water quality, three risk factors (crowding + air exposure, salinity, and nitrite) were selected to study their relationship with fish mortality and Vibrio vulnificus disease outbreaks. CS-4 was diluted with PBS to a concentration of 5.7 × 10⁵ CFU/mL (LD₅₀ of IMM-N route). The experiment was divided into three sub-experiments (A, S, and N). Each sub-experiment condition was set simulating the external stresses the tilapia broodstock might have experienced during the handling process before the disease broke out (

Table 2. Grou** and treatments of external stressor experiments.

Group	Sub-Experiment A	Sub-Experiment S	Sub-Experiment N
Treatment #1	Crowding stress (20 min) + air exposure (20 min) + freshwater	NaCl (6 g/L)	NaNO2 (2 mg/L)
Treatment #2	Crowding stress (20 min) + air exposure (20 min) + CS-4 (20 min) + freshwater	CS-4 (20 min) + NaCl (6 g/L)	CS-4 (20 min) + NaNO2 (2 mg/L)
Control	CS-4 (20 min) + freshwater
Blank	freshwater

).

In sub-experiment A (crowding stress and air exposure), fish in treatment #1 were subject to crowding stress (one-third of the tank water was discharged) for 20 min. After that, all tank water was discharged and fish were exposed to air for another 20 min before the tank was refilled with freshwater; fish in treatment #2 were subject to crowding stress for 20 min and air exposure for 20 min, and then they were immersed in a CS-4 suspension (5.7 × 10⁵ CFU/mL) for 20 min, and finally they were put back into freshwater; fish in the control group were first immersed in CS-4 (5.7 × 10⁵ CFU/mL) for 20 min, and then they were put back into fresh water. Fish in the blank group were kept in fresh water all the time.

In sub-experiment S (salinity), fish in treatment #1 were put into a NaCl solution (6 g/L); fish in treatment #2 were first immersed in a CS-4 suspension (5.7 × 10⁵ CFU/mL) for 20 min, and then they were put into a NaCl solution (6 g/L). The control group and blank group were the same as in sub-experiment A.

In sub-experiment N (nitrite), fish in treatment #1 were put into a NaNO₂ solution (2 mg/L); fish in treatment #2 were first immersed in a CS-4 suspension (5.7 × 10⁵ CFU/mL) for 20 min, and then they were put into a NaNO₂ solution (2 mg/L). The control group and blank group were the same as in sub-experiment A.

All of the above external stressor experiments were conducted in parallel groups of two, each parallel containing 10 fish. Therefore, a total of 160 fish (10 fish/parallel × 2 parallels/group × 8 groups =160 fish) were used for external stressor experiments. The water temperature was set to 28 °C. Fish mortality was recorded every 24 h interval for 7 days.

3. Results

3.1. Water Quality Evaluation

The variation in water quality in broodstock ponds is shown in

Table 3. Water quality variations in broodstock pond water.

	Salinity (g/L)	Ammonia Nitrogen (mg/L)	Nitrate Nitrogen (mg/L)	Nitrite Nitrogen (mg/L)	Total Nitrogen (mg/L)	Total Phosphorus (mg/L)	Orthophosphate (μmol/L)	Chemical Oxygen Demand (mg/L)	Suspended Solids (mg/L)
Before RAS suspension	≤1	0.08	0.07	0.013	1.2	0.6	2.89	19.9	9
After water refill	6	0.04	0.20	0.115	2.2	1.1	3.06	28.6	26
During disease outbreak	6	0.06	0.15	0.95	1.8	1.3	2.32	24.7	25

.

3.2. Pathologic Diagnosis

3.2.1. Gross Observations

The diseased tilapia showed symptoms of surfacing, anorexia, erratic swimming behavior, and lateral recumbency. They exhibited signs of hemorrhaging on their surface, with noticeable ulcers present on both the dorsal fin and the body. Additionally, the fish’s gills displayed clear symptoms of congestion. Redness or erythematous patches were observed on the lower abdomen and lower mandibular region (Figure 3).

The belly of the fish had ascites. Autopsy showed generalized fat accumulation in the abdominal cavity, an uneven colored liver with congested blood vessels, an engorged gall bladder and splenomegaly, and yellowish transparent gelatinous fluid that filled the intestine. No external or internal parasites were observed (Figure 4).

3.2.2. Histopathology

Liver tissue exhibited poor structure, with liver cells displaying degeneration and necrosis, along with inflammatory cell infiltration (Figure 5A). In the intestine section, inflammatory cells infiltrated the submucosa, neutrophile granulocytes were distributed in the lamina propria, and mucosa cell apoptosis was evident, with some villi detaching (Figure 5B). The spleen section revealed marked congestion, with atrophy of the white pulp and an increase in the red pulp (Figure 5C).

3.3. Bacterial Isolation and Identification

3.3.1. Virulence Test

On LB agar, dominant bacteria formed single, circular colonies, around 2–4 mm in diameter. The colonies were opaque with a creamy or white appearance, exhibiting a smooth, shiny surface. They have slightly raised or low convex profiles with smooth edges. Finally, four potential pathogenic strains, named CS-1, CS-2, CS-3, and CS-4, respectively, were isolated from the liver, spleen, kidney, and brain of diseased fish. The intraperitoneal injection of CS-1, CS-2, CS-3, and CS-4 revealed that all four isolates were lethal to healthy tilapia. All artificially infected fish exhibited clinical signs of surfacing, anorexia, erratic swimming behavior, lateral recumbency, and ultimately acute mortality. In all artificial infection groups, the dominant strains were successfully re-isolated from the spleen and liver of moribund or deceased fish. Among all groups, those injected with CS-4 experienced the earliest and most rapid mortality, with 100% cumulative mortality reached within 10 h. Consequently, CS-4 was deemed the most virulent strain and was selected for subsequent experiments.

3.3.2. Physiological and Biochemical Tests

The CS-4 colony is round, milky white, moist, convex, and smooth, with a diameter of 1–2 mm. CS-4 was positive for oxidase, catalase, lysine decarboxylase, esculin hydrolysis, mannitol, rhamnose, mannose, glucose, citrate, ONPG, cellobiose, and indole, but negative for the VP reaction, malonate, arginine hydrolase, lactose, sorbitol, salicin, etc. The physiological and biochemical results showed that this strain is most similar to V. vulnificus based on Bergey’ Manual of determinative bacteriology [15] (

Table A1. Comparative physiological and biochemical analysis of CS-4 isolated from diseased tilapia broodstock in comparison with published biochemical data of Vibrio vulnificus (n = 3).

Biochemical Test	CS-4	Vibrio vulnificus ATCC27562
Gram staining	−	−
TCBS growth	G	G
Not NaCl tryptone broth	−	−
1% NaCl tryptone broth	+	+
3% NaCl tryptone broth	+	+
6% NaCl tryptone broth	+	+
8% NaCl tryptone broth	−	−
10% NaCl tryptone broth	−	−
ONPG reaction	+	N
Catalase	+	+
Oxidase	+	N
VP reaction	−	N
Malonate	−	−
Arginine hydrolase	−	−
Iysine decarboxylase	+	+
Esculin hydrolysis	+	N
Mannitol	+	N
Rhamnose	+	−
Mannose	+	+
Lactose	−	N
Sorbitol	−	−
Glucose	+	+
Citrate	+	N
Cellobiose	+	+
Indole production	+	N
Salican	−	+

Note: “+”: positive, “−”: negative, “G”: green, “N”: not given.

).

3.3.3. Sequence Analysis of 16S rRNA Gene

The four isolate sequences formed a tight clade that branched within genus Vibrio. Meanwhile, the 16S rRNA sequences of CS-1, CS-2, CS-3, and CS-4 showed high homology to V. vulnificus ATCC27562 (GenBank accession number CP012881.1), with percentages of 99.70%, 99.79%, 99.44%, and 99.79%, respectively (Figure 6).

3.3.4. Antimicrobial Susceptibility Results

The susceptibility pattern of isolate CS-4 against 25 antibacterial agents was investigated. CS-4 was susceptible to Norfloxacin, Rifampicin, Florfenicol, Nalidixic acid, Mezlocillin, Trimethoprim, Tetracycline, Gentamycin, Kanamycin, Streptomycin, Tobramycin, Neomycin, Aboren, Vancomycin, Cotrimoxazole, Amoxicillin, Doxycycline, Cefamandole, and Enrofloxacin. CS-4 was resistant to Penicillin, Lincomycin, and Polymyxin B. CS-4 showed intermediate resistance to Cefradine, Cefotaxime, and Bacitracin (

Table A2. Sensitivity of the CS-4 strain to antibacterial agents (n = 3).

Antibiotics	Content (μg/Tablet)	Diameters of Inhibition Zone (mm)	Critical Range			Susceptibility
			R (mm)	I (mm)	S (mm)
Penicillin	10 U	18.59 ± 0.50	≤19	20–27	≥28	R
Mezlocillin	75	19.58 ± 0.53	≤17	18–20	≥21	S
Cefradine	30	15.18 ± 2.61	≤14	15–17	≥18	I
Cefotaxime	30	20.42 ± 2.05	≤14	15–22	≥23	I
Gentamicin	10	20.33 ± 0.85	≤12	13–14	≥15	S
Kanamycin	30	18.89 ± 0.56	≤13	14–17	≥18	S
Streptomycin	10	18.71 ± 0.94	≤11	12–14	≥15	S
Tobramycin	10	17.44 ± 1.10	≤12	13–14	≥15	S
Neomycin	30	15.59 ± 0.80	≤12	13–16	≥17	S
Tetracycline	30	22.84 ± 1.74	≤14	15–18	≥19	S
Nalidixic acid	30	26.48 ± 1.56	≤13	14–18	≥19	S
Aboren	30	19.32 ± 0.68	≤13	14–17	≥18	S
Lincomycin	2	0.00	≤14	15–20	≥21	R
Vancomycin	30	13.22 ± 0.62	≤9	10–11	≥12	S
Polymyxin B	300	0.00	≤8	8–11	≥12	R
Cotrimoxazole	25	28.11 ± 1.55	≤10	11–15	≥16	S
Amoxicillin	20	18.3 ± 0.37	≤13	14–17	≥18	S
Rifampicin	5	24.31 ± 0.83	≤16	17–19	≥20	S
Trimethoprim	5	20.70 ± 1.27	≤10	11–15	≥16	S
Enrofloxacin	10	23.34 ± 0.64	≤15	16–20	≥21	S
Bacitracin	10 U	10.66 ± 0.71	≤8	9–12	≥13	I
Florfenicol	30	24.18 ± 1.22	≤12	13–17	≥18	S
Cefamandole	30	18.50 ± 0.35	≤14	15–17	≥18	S
Doxycycline	30	20.47 ± 1.33	≤12	13–15	≥16	S
Norfloxacin	10	27.91 ± 1.49	≤12	13–16	≥17	S

Note: “S”: sensitive; “I”: intermediate; “R”: resistant.

).

3.3.5. Challenge Experiments and LD50 Values

The cumulative mortality rates of tilapia challenged through different infection routes with different doses of V. vulnificus CS-4 within 7 days post challenge are shown in Figure 7. There was no mortality in the control fish injected with PBS up to 7 days post injection. The LD50 values of V. vulnificus through intramuscular injection, intraperitoneal injection, and immersion were 1.67 × 10³ CFU/mL, 3.33 × 10² CFU/mL, and 5.7 × 10⁵ CFU/mL, respectively. Bacterial strains were re-isolated from the dying fish and were identical to the injected strain.

3.4. Analysis and Influence of Risk Factors

Influence of crowding stress + air exposure is shown in Figure 8A. Compared to the group directly infected with V. vulnificus, the tilapia group infected with V. vulnificus after 20 min of crowding stress and air exposure showed a significantly reduced 7-day cumulative mortality. At the same time, the combination of crowding stress and air exposure alone (with no V. vulnificus infection) did not result in any tilapia death.

Influence of salinity is shown in Figure 8B. Obviously, tilapia infected with V. vulnificus were more likely to die in higher-salinity (6 g/L) water compared to fresh water. Meanwhile, the tilapia group not infected with V. vulnificus did not die in the NaCl (6 g/L) water environment.

Influence of nitrite is shown in Figure 8C. V. vulnificus-infected tilapia showed a similar 7-day cumulative mortality in 2 mg/L NaNO₂ concentration water compared to fresh water. Meanwhile, the tilapia group not infected with V. vulnificus did not die in the 2 mg/L NaNO₂ water environment.

4. Discussion

V. vulnificus is an important pathogen of “human and fish disease” [16,17]. With the fast development of the tilapia farming industry, various infectious diseases have been reported in recent years [18]. In the present study, all four isolates obtained from diseased tilapia were identified as V. vulnificus and resulted in mortality. It has long been recognized that three biotypes of V. vulnificus have been identified: biotype 1 strains are mainly found in fish and shellfish, pathogenic to humans, and produce indole; biotype 2 strains are pathogenic to both eels and shrimps and humans, producing no indole; and biotype 3 strains are only associated with human diseases [19]. V. vulnificus CS-4 is infectious to fish and produces indole, and therefore CS-4 should be classified as biotype I. A deeper understanding of the biological characteristics of V. vulnificus can help prevent and treat bacterial diseases caused by V. vulnificus.

An analysis of antimicrobial susceptibility of pathogen bacteria is crucial for formulating effective disease control programs and local antibiotic reduction policies [20]. In this study, antimicrobial susceptibility tests revealed that CS-4 was resistant to only 3 antibiotics out of the 24 tested antibiotics: Penicillin, Lincomycin, and Polymyxin B. When comparing the multiple antibiotic resistance (MAR) of the isolate in the current study to the findings of [21], which evaluated the susceptibility of five V. vulnificus isolates sourced from diseased marine/estuarine fishes and reported an MAR range of 0.05–0.45, it is observed that the MAR of the present study, with 3 out of 24 antibiotics showing resistance (MAR of 0.125), falls within the lower end of the reported MAR spectrum [21]. In another investigation of 60 V. vulnificus isolates from Malaysia and Qatar, the MAR values ranged from 0.2 to 0.7, with an average of 0.42 [22]. Therefore, the MAR of CS-4 is relatively low compared to the V. vulnificus isolates from the aforementioned studies. Generally speaking, low MAR values of bacterial isolates from a particular region suggest that the area has low antibiotic usage [23]. However, the present study assesses the MAR of only one isolate. To conclusively determine if the region is indeed a low-antibiotic-usage area, MAR values from more isolates are needed. Even though strain CS-4 is sensitive to many antibiotics, it is not recommended to use large quantities of antibiotics against V. vulnificus. This is because continuous use of antibiotics may reduce their efficacy and promote the development of antibiotic resistance [24].

Little information is available on the natural route of bacterial infection, and the route through which V. vulnificus invades fish remains unknown. Soto et al. (2016) compared four different entry routes of S. agalactiae through tilapia challenge experiments, and concluded that injectable methods of infection (i.p. and i.s.) may not accurately mimic natural disease, whereas oral and immersion challenge routes more closely resemble natural infection [25]. Our experiment results showed low mortality in the immersion group; however, after epidermal injury, the mortality rate of the immersion group increased sharply, reaching 100% within 24 h. Based on these experiments, we infer that V. vulnificus might enter tilapia (without epidermal injury) through the gills, body surface, or digestive tract, often resulting in chronic infection. Once the fish has epidermal injuries (wounds), immersion in V. vulnificus can lead to acute death. Considering that the disease outbreak occurred after the broodstock was transferred to another pond, we suspect that the handling procedures might have caused minor damages to the fish’s body surface mucosa, thereby exacerbating the damage caused by V. vulnificus infection.

During fish husbandry and production cycles, certain handling procedures, such as exposing fish to air environments, are unavoidable. Because air exposure induces various physiological disturbances in fish, it is commonly regarded as an acute stressor in aquaculture [26]. Previous studies have shown that exposing fish to air can limit oxygen supply, cause hypoxia, affect the oxidative metabolism of the fish’s brain, and even reduce the fish’s survival rate [27,28]. However, Arleta et al. (2018) believe that air exposure helps alleviate the pressure of breeding activities (such as size selection, capture, and transport) in olive flounder farming [29]. Interestingly, in this study, a 20 min air-exposure treatment also significantly reduced the cumulative mortality of the tilapia group infected with V. vulnificus compared to the group directly infected with V. vulnificus. Apparently, air exposure stress stimulation helped improve tilapia immunity against V. vulnificus. The mechanism of air exposure’s protective effect against V. vulnificus infection is still unknown, and it needs to be studied in future research.

Water salinity has a certain influence on the immune competence of different euryhaline fish species [30,31,32]. Water salinity over tolerance limits of fish may inhibit the activity of a variety of antioxidant enzymes, trigger the suppression of the immune system, and compromise disease resistance in fish [33,34,35]. However, tilapia fish are euryhaline fish. Studies have shown that in 5 g/L and 15 g/L salinity, the non-specific immunity and disease resistance of tilapia were not significantly different from tilapia in 0 g/L salinity [36]. Similarly, our study also revealed that fish in 6 g/L salinity had the same survival rate as fish in 0 g/L salinity (Figure 7). However, after the V. vulnificus challenge, the mortality rate of tilapia in 6 g/L salinity was significantly higher than that of tilapia in fresh water. This might be explained by the fact that V. vulnificus is a halophilic bacterium, and that salt concentration of 5 g/L to 25 g/L promotes the proliferation of V. vulnificus [36]. Therefore, although tilapia could adapt well to a salinity of 6 g/L, an increase in salinity will benefit the proliferation of V. vulnificus, enhance its invasion and virulence, and consequently increase the susceptibility of tilapia to V. vulnificus, leading to higher mortality from V. vulnificus infection.

Exposure to nitrite can induce metabolic and immune changes in fish [37,38,39,40]. In this study, compared with tilapia in the freshwater group, the cumulative mortality rate of tilapia in the 2 mg/L NaNO₂ group remained unchanged for 7 days, but the daily mortality rate decreased initially and then increased. Under the short-term influence of nitrite, fish can detoxify by oxidizing nitrite into low-toxic nitrate through hemoglobin, red blood cells, catalase (CAT), and cytochrome oxidase (CYTO). Therefore, environments with a higher concentration of nitrite in a short period of time make tilapia more adaptable, increase their resistance to V. vulnificus infection, and reduce mortality. However, beyond a certain threshold, nitrite can cause damage to the fish’s body. Studies have shown that high concentrations of nitrite have toxic effects on physiological processes, including stress induction, growth inhibition, oxidative damage, and immunosuppression in fish [41,42]. Consequently, the mortality rate of the 2 mg/L NaNO₂ group initially decreased and then increased.

5. Conclusions

During the suspension of a GIFT tilapia broodstock recirculating aquaculture system (RAS) in Hainan, a significant fish mortality event occurred, and our experimental results indicated that the primary etiological agent responsible for the disease breakout was Vibrio vulnificus. The pathogen’s relatively low level of multiple antibiotic resistance might indicate that the region where the tilapia broodstock farm is situated, specifically Lingao in Hainan Province, China, remains an area with minimal antibiotic usage. Challenge experiments have demonstrated that minor wounds on the fish’s body surface, potentially incurred during the process of transferring fish between pools, are the most probable route of infection. Additionally, external stressor experiments have revealed that among the three suspected stress factors—crowding combined with air exposure, water salinity, and water nitrite levels—it is the increase in water salinity that appears to be the predominant factor contributing to the onset of this particular tilapia broodstock infection. The findings of this study underscore the critical importance of maintaining optimal water quality and stable environmental conditions for the health of tilapia broodstock. Additionally, these results are expected to serve as a valuable reference for the disease prevention and management of tilapia cultured in RAS, ultimately enhancing the production and breeding level of tilapia in the future.