Bta-miR-24-3p Controls the Myogenic Differentiation and Proliferation of Fetal Bovine Skeletal Muscle-Derived Progenitor Cells by Targeting ACVR1B
Abstract
:Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Ethics Statement
2.2. Primary Cell Isolation and Cell Culture
2.3. RNA Isolation, Reverse Transcription (RT), and Quantitative Real-Time PCR (qRT-PCR)
2.4. Immunofluorescence
2.5. Western Blot
2.6. 5-Ethynyl-2′-deoxyuridine (EdU) Assay
2.7. Cell Counting Kit-8 (CCK8) Assay
2.8. RNA Oligonucleotide Preparation and Cell Transfection
2.9. Prediction of miRNA Target Genes
2.10. Dual-Luciferase Reporter Assay
2.11. Statistical Analysis
3. Results
3.1. Bta-miR-24-3p Is Up-Regulated During the Myogenic Differentiation of PDGFRα- Progenitor Cells
3.2. Bta-miR-24-3p Promotes the Myogenic Differentiation of Bovine PDGFRα- Progenitor Cells
3.3. Bta-miR-24-3p Inhibits Bovine PDGFRα- Progenitor Cell Proliferation
3.4. ACVR1B Is a Direct Target of Bta-miR-24-3p
3.5. ACVR1B Silencing Promotes Myogenic Differentiation But Inhibits Proliferation
4. Discussion
5. Conclusions
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Du, M.; Tong, J.; Zhao, J.; Underwood, K.R.; Zhu, M.; Ford, S.P.; Nathanielsz, P.W. Fetal programming of skeletal muscle development in ruminant animals. J. Anim. Sci. 2010, 88, E51–E60. [Google Scholar] [CrossRef] [PubMed]
- Sabourin, L.A.; Rudnicki, M.A. The molecular regulation of myogenesis. Clin. Genet. 2000, 57, 16–25. [Google Scholar] [CrossRef] [PubMed]
- Lassar, A.B.; Skapek, S.X.; Novitch, B. Regulatory mechanisms that coordinate skeletal muscle differentiation and cell cycle withdrawal. Curr. Opin. Cell Biol. 1994, 6, 788–794. [Google Scholar] [CrossRef]
- Pownall, M.E.; Gustafsson, M.K.; Emerson, C.P., Jr. Myogenic regulatory factors and the specification of muscle progenitors in vertebrate embryos. Annu. Rev. Cell Dev. Biol. 2002, 18, 747–783. [Google Scholar] [CrossRef]
- Yun, K.; Wold, B. Skeletal muscle determination and differentiation: Story of a core regulatory network and its context. Curr. Opin. Cell Biol. 1996, 8, 877–889. [Google Scholar] [CrossRef]
- Bartel, D.P. MicroRNAs: Genomics, biogenesis, mechanism, and function. Cell 2004, 116, 281–297. [Google Scholar] [CrossRef]
- Wahid, F.; Shehzad, A.; Khan, T.; Kim, Y.Y. MicroRNAs: Synthesis, mechanism, function, and recent clinical trials. BBA Mol. Cell Res. 2010, 1803, 1231–1243. [Google Scholar] [CrossRef] [Green Version]
- **e, S.J.; Li, J.H.; Chen, H.F.; Tan, Y.Y.; Liu, S.R.; Zhang, Y.; Xu, H.; Yang, J.H.; Liu, S.; Zheng, L.L.; et al. Inhibition of the JNK/MAPK signaling pathway by myogenesis-associated miRNAs is required for skeletal muscle development. Cell Death Differ. 2018, 25, 1581–1597. [Google Scholar] [CrossRef] [Green Version]
- Zhang, Y.; Yan, H.; Zhou, P.; Zhang, Z.; Liu, J.; Zhang, H. MicroRNA-152 Promotes Slow-Twitch Myofiber Formation via Targeting Uncoupling Protein-3 Gene. Animals 2019, 9. [Google Scholar] [CrossRef]
- Zhang, W.R.; Zhang, H.N.; Wang, Y.M.; Dai, Y.; Liu, X.F.; Li, X.; Ding, X.B.; Guo, H. miR-143 regulates proliferation and differentiation of bovine skeletal muscle satellite cells by targeting IGFBP5. In Vitro Cell Dev. Biol. Anim. 2017, 53, 265–271. [Google Scholar] [CrossRef]
- Song, C.; Yang, J.; Jiang, R.; Yang, Z.; Li, H.; Huang, Y.; Lan, X.; Lei, C.; Ma, Y.; Qi, X.; et al. miR-148a-3p regulates proliferation and apoptosis of bovine muscle cells by targeting KLF6. J. Cell. Physiol. 2019, 234. [Google Scholar] [CrossRef] [PubMed]
- Tong, H.; Jiang, R.; Liu, T.; Wei, Y.; Li, S.; Yan, Y. bta-miR-378 promote the differentiation of bovine skeletal muscle-derived satellite cells. Gene 2018, 668, 246–251. [Google Scholar] [CrossRef] [PubMed]
- Sun, Q.; Zhang, Y.; Yang, G.; Chen, X.; Zhang, Y.; Cao, G.; Wang, J.; Sun, Y.; Zhang, P.; Fan, M.; et al. Transforming growth factor-beta-regulated miR-24 promotes skeletal muscle differentiation. Nucleic Acids Res. 2008, 36, 2690–2699. [Google Scholar] [CrossRef] [PubMed]
- Sun, Y.; Wang, H.; Li, Y.; Liu, S.; Chen, J.; Ying, H. miR-24 and miR-122 Negatively Regulate the Transforming Growth Factor-beta/Smad Signaling Pathway in Skeletal Muscle Fibrosis. Mol. Nucleic Acids 2018, 11, 528–537. [Google Scholar] [CrossRef]
- Zimmerman, C.M.; Mathews, L.S. Activin receptors: Cellular signalling by receptor serine kinases. Biochem. Soc. Symp. 1996, 62, 25–38. [Google Scholar]
- Reissmann, E.; Jornvall, H.; Blokzijl, A.; Andersson, O.; Chang, C.; Minchiotti, G.; Persico, M.G.; Ibanez, C.F.; Brivanlou, A.H. The orphan receptor ALK7 and the Activin receptor ALK4 mediate signaling by Nodal proteins during vertebrate development. Genes Dev. 2001, 15, 2010–2022. [Google Scholar] [CrossRef] [Green Version]
- Ramsdell, A.F.; Bernanke, J.M.; Trusk, T.C. Left-right lineage analysis of the embryonic Xenopus heart reveals a novel framework linking congenital cardiac defects and laterality disease. Development 2006, 133, 1399–1410. [Google Scholar] [CrossRef] [Green Version]
- Pasteuning-Vuhman, S.; Boertje-van der Meulen, J.W.; van Putten, M.; Overzier, M.; Ten Dijke, P.; Kielbasa, S.M.; Arindrarto, W.; Wolterbeek, R.; Lezhnina, K.V.; Ozerov, I.V.; et al. New function of the myostatin/activin type I receptor (ALK4) as a mediator of muscle atrophy and muscle regeneration. FASEB J. Off. Publ. Fed. Am. Soc. Exp. Biol. 2017, 31, 238–255. [Google Scholar] [CrossRef]
- Mizuno, Y.; Tokuzawa, Y.; Ninomiya, Y.; Yagi, K.; Yatsuka-Kanesaki, Y.; Suda, T.; Fukuda, T.; Katagiri, T.; Kondoh, Y.; Amemiya, T.; et al. miR-210 promotes osteoblastic differentiation through inhibition of AcvR1b. FEBS Lett. 2009, 583, 2263–2268. [Google Scholar] [CrossRef]
- Qiu, W.; Li, X.; Tang, H.; Huang, A.S.; Panteleyev, A.A.; Owens, D.M.; Su, G.H. Conditional activin receptor type 1B (Acvr1b) knockout mice reveal hair loss abnormality. J. Investig. Dermatol. 2011, 131, 1067–1076. [Google Scholar] [CrossRef]
- Uezumi, A.; Fukada, S.; Yamamoto, N.; Takeda, S.; Tsuchida, K. Mesenchymal progenitors distinct from satellite cells contribute to ectopic fat cell formation in skeletal muscle. Nat. Cell Biol. 2010, 12, 143–152. [Google Scholar] [CrossRef] [PubMed]
- Guan, L.; Hu, X.; Liu, L.; **ng, Y.S.; Zhou, Z.K.; Liang, X.W.; Yang, Q.Y.; **, S.Y.; Bao, J.S.; Gao, H.J.; et al. bta-miR-23a involves in adipogenesis of progenitor cells derived from fetal bovine skeletal muscle. Sci. Rep. UK 2017, 7. [Google Scholar] [CrossRef] [PubMed]
- Yu, F.; Pang, G.; Zhao, G. ANRIL acts as onco-lncRNA by regulation of microRNA-24/c-Myc, MEK/ERK and Wnt/beta-catenin pathway in retinoblastoma. Int. J. Biol. Macromol. 2019, 128, 583–592. [Google Scholar] [CrossRef] [PubMed]
- Zhu, Y.; Sun, Y.; Zhou, Y.; Zhang, Y.; Zhang, T.; Li, Y.; You, W.; Chang, X.; Yuan, L.; Han, X. MicroRNA-24 promotes pancreatic beta cells toward dedifferentiation to avoid endoplasmic reticulum stress-induced apoptosis. J. Mol. Cell Biol. 2019. [Google Scholar] [CrossRef] [PubMed]
- Wang, J.; Yin, K.; Lv, X.; Yang, Q.; Shao, M.; Liu, X.; Sun, H. MicroRNA-24-3p regulates Hodgkin’s lymphoma cell proliferation, migration and invasion by targeting DEDD. Oncol. Lett. 2019, 17, 365–371. [Google Scholar] [CrossRef] [PubMed]
- Lin, Y.; Yang, Y. MiR-24 inhibits inflammatory responses in LPS-induced acute lung injury of neonatal rats through targeting NLRP3. Pathol. Res. Pract. 2019, 215, 683–688. [Google Scholar] [CrossRef] [PubMed]
- **ao, X.; Lu, Z.; Lin, V.; May, A.; Shaw, D.H.; Wang, Z.; Che, B.; Tran, K.; Du, H.; Shaw, P.X. MicroRNA miR-24-3p Reduces Apoptosis and Regulates Keap1-Nrf2 Pathway in Mouse Cardiomyocytes Responding to Ischemia/Reperfusion Injury. Oxidative Med. Cell. Longev. 2018, 2018, 7042105. [Google Scholar] [CrossRef]
- Yan, L.; Ma, J.; Zhu, Y.; Zan, J.; Wang, Z.; Ling, L.; Li, Q.; Lv, J.; Qi, S.; Cao, Y.; et al. miR-24-3p promotes cell migration and proliferation in lung cancer by targeting SOX7. J. Cell. Biochem. 2018, 119, 3989–3998. [Google Scholar] [CrossRef]
- Wang, Q.; Huang, Z.; Xue, H.; **, C.; Ju, X.L.; Han, J.D.; Chen, Y.G. MicroRNA miR-24 inhibits erythropoiesis by targeting activin type I receptor ALK4. Blood 2008, 111, 588–595. [Google Scholar] [CrossRef]
- Li, Z.; Sun, Y.; Cao, S.; Zhang, J.; Wei, J. Downregulation of miR-24-3p promotes osteogenic differentiation of human periodontal ligament stem cells by targeting SMAD family member 5. J. Cell. Physiol. 2019, 234, 7411–7419. [Google Scholar] [CrossRef]
- **, L.; Li, Y.; Nie, L.; He, T.; Hu, J.; Liu, J.; Chen, M.; Shi, M.; Jiang, Z.; Gui, Y.; et al. MicroRNA242 is associated with cell proliferation, invasion, migration and apoptosis in renal cell carcinoma. Mol. Med. Rep. 2017, 16, 9157–9164. [Google Scholar] [CrossRef] [PubMed]
- Hua, K.; Chen, Y.T.; Chen, C.F.; Tang, Y.S.; Huang, T.T.; Lin, Y.C.; Yeh, T.S.; Huang, K.H.; Lee, H.C.; Hsu, M.T.; et al. MicroRNA-23a/27a/24-2 cluster promotes gastric cancer cell proliferation synergistically. Oncol. Lett. 2018, 16, 2319–2325. [Google Scholar] [CrossRef] [PubMed]
- Zhou, N.; Yan, H.L. MiR-24 promotes the proliferation and apoptosis of lung carcinoma via targeting MAPK7. Eur. Rev. Med. Pharmacol. Sci. 2018, 22, 6845–6852. [Google Scholar] [CrossRef] [PubMed]
- Liu, L.; Pan, J.; Wang, H.; Ma, Z.; Yin, J.; Yuan, F.; Yuan, Q.; Zhou, L.; Liu, X.; Zhang, Y.; et al. von Willebrand factor rescued by miR-24 inhibition facilitates the proliferation and migration of osteosarcoma cells in vitro. Biosci. Rep. 2018, 38. [Google Scholar] [CrossRef] [PubMed]
- Yu, G.; Jia, Z.; Dou, Z. miR-24-3p regulates bladder cancer cell proliferation, migration, invasion and autophagy by targeting DEDD. Oncol. Rep. 2017, 37, 1123–1131. [Google Scholar] [CrossRef] [PubMed]
- Yang, J.; Chen, L.; Ding, J.; Fan, Z.; Li, S.; Wu, H.; Zhang, J.; Yang, C.; Wang, H.; Zeng, P.; et al. MicroRNA-24 inhibits high glucose-induced vascular smooth muscle cell proliferation and migration by targeting HMGB1. Gene 2016, 586, 268–273. [Google Scholar] [CrossRef]
- Lal, A.; Navarro, F.; Maher, C.A.; Maliszewski, L.E.; Yan, N.; O’Day, E.; Chowdhury, D.; Dykxhoorn, D.M.; Tsai, P.; Hofmann, O.; et al. miR-24 Inhibits cell proliferation by targeting E2F2, MYC, and other cell-cycle genes via binding to “seedless” 3’UTR microRNA recognition elements. Mol. Cell 2009, 35, 610–625. [Google Scholar] [CrossRef]
- Feng, X.H.; Derynck, R. Specificity and versatility in tgf-beta signaling through Smads. Annu. Rev. Cell Dev. Biol. 2005, 21, 659–693. [Google Scholar] [CrossRef]
- Song, C.; Fan, B.; **ao, Z. Overexpression of ALK4 inhibits cell proliferation and migration through the inactivation of JAK/STAT3 signaling pathway in glioma. Biomed. Pharmacother. 2018, 98, 440–445. [Google Scholar] [CrossRef]
- Zhu, S.; Goldschmidt-Clermont, P.J.; Dong, C. Transforming growth factor-beta-induced inhibition of myogenesis is mediated through Smad pathway and is modulated by microtubule dynamic stability. Circ. Res. 2004, 94, 617–625. [Google Scholar] [CrossRef]
- De Angelis, L.; Borghi, S.; Melchionna, R.; Berghella, L.; Baccarani-Contri, M.; Parise, F.; Ferrari, S.; Cossu, G. Inhibition of myogenesis by transforming growth factor beta is density-dependent and related to the translocation of transcription factor MEF2 to the cytoplasm. Proc. Natl. Acad. Sci. USA 1998, 95, 12358–12363. [Google Scholar] [CrossRef] [PubMed]
- Liu, D.; Black, B.L.; Derynck, R. TGF-beta inhibits muscle differentiation through functional repression of myogenic transcription factors by Smad3. Genes Dev. 2001, 15, 2950–2966. [Google Scholar] [CrossRef] [PubMed]
- Murakami, M.; Ohkuma, M.; Nakamura, M. Molecular mechanism of transforming growth factor-beta-mediated inhibition of growth arrest and differentiation in a myoblast cell line. Dev. Growth Differ. 2008, 50, 121–130. [Google Scholar] [CrossRef] [PubMed]
- Matsumoto, Y.; Otsuka, F.; Hino, J.; Miyoshi, T.; Takano, M.; Miyazato, M.; Makino, H.; Kangawa, K. Bone morphogenetic protein-3b (BMP-3b) inhibits osteoblast differentiation via Smad2/3 pathway by counteracting Smad1/5/8 signaling. Mol. Cell. Endocrinol. 2012, 350, 78–86. [Google Scholar] [CrossRef] [PubMed]
- Rebbapragada, A.; Benchabane, H.; Wrana, J.L.; Celeste, A.J.; Attisano, L. Myostatin Signals through a Transforming Growth Factor β-Like Signaling Pathway To Block Adipogenesis. Mol. Cell. Biol. 2003, 23, 7230–7242. [Google Scholar] [CrossRef] [PubMed]
- Levine, A.J.; Brivanlou, A.H. GDF3 at the crossroads of TGF-beta signaling. Cell Cycle 2006, 5, 1069–1073. [Google Scholar] [CrossRef]
- Hata, A.; Chen, Y.G. TGF-beta Signaling from Receptors to Smads. Cold Spring Harb. Perspect. Biol. 2016, 8. [Google Scholar] [CrossRef]
- Hill, C.S. Transcriptional Control by the SMADs. Cold Spring Harb. Perspect. Biol. 2016, 8. [Google Scholar] [CrossRef]
- Hinck, A.P. Structural studies of the TGF-betas and their receptors - insights into evolution of the TGF-beta superfamily. FEBS Lett. 2012, 586, 1860–1870. [Google Scholar] [CrossRef]
- Clop, A.; Marcq, F.; Takeda, H.; Pirottin, D.; Tordoir, X.; Bibe, B.; Bouix, J.; Caiment, F.; Elsen, J.M.; Eychenne, F.; et al. A mutation creating a potential illegitimate microRNA target site in the myostatin gene affects muscularity in sheep. Nat. Genet. 2006, 38, 813–818. [Google Scholar] [CrossRef]
- McPherron, A.C.; Lawler, A.M.; Lee, S.J. Regulation of skeletal muscle mass in mice by a new TGF-beta superfamily member. Nature 1997, 387, 83–90. [Google Scholar] [CrossRef] [PubMed]
- McPherron, A.C.; Lee, S.J. Double muscling in cattle due to mutations in the myostatin gene. Proc. Natl. Acad. Sci. USA 1997, 94, 12457–12461. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kemaladewi, D.U.; de Gorter, D.J.; Aartsma-Rus, A.; van Ommen, G.J.; ten Dijke, P.; ’t Hoen, P.A.; Hoogaars, W.M. Cell-type specific regulation of myostatin signaling. FASEB J. Off. Publ. Fed. Am. Soc. Exp. Biol. 2012, 26, 1462–1472. [Google Scholar] [CrossRef] [PubMed]
- Langley, B.; Thomas, M.; Bishop, A.; Sharma, M.; Gilmour, S.; Kambadur, R. Myostatin inhibits myoblast differentiation by down-regulating MyoD expression. J. Biol. Chem. 2002, 277, 49831–49840. [Google Scholar] [CrossRef] [PubMed]
- Joulia, D.; Bernardi, H.; Garandel, V.; Rabenoelina, F.; Vernus, B.; Cabello, G. Mechanisms involved in the inhibition of myoblast proliferation and differentiation by myostatin. Exp. Cell Res. 2003, 286, 263–275. [Google Scholar] [CrossRef]
- Taylor, W.E.; Bhasin, S.; Artaza, J.; Byhower, F.; Azam, M.; Willard, D.H., Jr.; Kull, F.C., Jr.; Gonzalez-Cadavid, N. Myostatin inhibits cell proliferation and protein synthesis in C2C12 muscle cells. Am. J. Physiol. Endocrinol. Metab. 2001, 280, E221–E228. [Google Scholar] [CrossRef]
- Thomas, M.; Langley, B.; Berry, C.; Sharma, M.; Kirk, S.; Bass, J.; Kambadur, R. Myostatin, a negative regulator of muscle growth, functions by inhibiting myoblast proliferation. J. Biol. Chem. 2000, 275, 40235–40243. [Google Scholar] [CrossRef]
- Garikipati, D.K.; Rodgers, B.D. Myostatin inhibits myosatellite cell proliferation and consequently activates differentiation: Evidence for endocrine-regulated transcript processing. J. Endocrinol. 2012, 215, 177–187. [Google Scholar] [CrossRef]
- Rodgers, B.D.; Wiedeback, B.D.; Hoversten, K.E.; Jackson, M.F.; Walker, R.G.; Thompson, T.B. Myostatin stimulates, not inihibits, C2C12 myoblast proliferation. Endocrinology 2014, 155, 670–675. [Google Scholar] [CrossRef]
- Manceau, M.; Gros, J.; Savage, K.; Thome, V.; McPherron, A.; Paterson, B.; Marcelle, C. Myostatin promotes the terminal differentiation of embryonic muscle progenitors. Genes Dev. 2008, 22, 668–681. [Google Scholar] [CrossRef] [Green Version]
- Chen, X.; Huang, Z.; Chen, D.; Yang, T.; Liu, G. Role of microRNA-27a in myoblast differentiation. Cell Biol. Int. 2014, 38, 266–271. [Google Scholar] [CrossRef] [PubMed]
- Zhang, A.; Li, M.; Wang, B.; Klein, J.D.; Price, S.R.; Wang, X.H. miRNA-23a/27a attenuates muscle atrophy and renal fibrosis through muscle-kidney crosstalk. J. Cachexia Sarcopenia Muscle 2018, 9, 755–770. [Google Scholar] [CrossRef]
- Wang, B.; Zhang, C.; Zhang, A.; Cai, H.; Price, S.R.; Wang, X.H. MicroRNA-23a and MicroRNA-27a Mimic Exercise by Ameliorating CKD-Induced Muscle Atrophy. J. Am. Soc. Nephrol. JASN 2017, 28, 2631–2640. [Google Scholar] [CrossRef] [PubMed]
- Wang, Y.; Luo, J.; Zhang, H.; Lu, J. microRNAs in the Same Clusters Evolve to Coordinately Regulate Functionally Related Genes. Mol. Biol. Evol. 2016, 33, 2232–2247. [Google Scholar] [CrossRef] [PubMed] [Green Version]
Name | Forward (5’–3’) | Reverse (5’–3’) |
---|---|---|
MyoG | CAAATCCACTCCCTGAAA | GCATAGGAAGAGATGAACA |
MYH1 | GGGAAACTGGCTTCTGCTGAT | TGGGTTGGTGGTGATTAGGAG |
MYH2 | GTCAAAGGGACTATCCAGAGCAG | AGAAGAGGCCCGAGTAGGTGT |
MYH4 | CTCCTAATCACCACCAACCCATA | TGTCAGCAACTTCAGTGCCATC |
MYH7 | AAGACAGTGACCGTGAAGGAGG | GGTTGATGGTGACGCAGAAGA |
ACVR1B | TGCCCTCTGACCCTTCCATC | CACTCCCGCATCATCTTCCC |
bta-miR-24-3p | CAGTGGCTCAGTTCAGCAGGA | |
18s | GTAACCCGTTGAACCCCATT | CCATCCAATCGGTAGTAGCG |
Cyclin D1 | GACGAGCTGCTGCACATGGA | TGCTTGTTCTCCTCGGCCAC |
Cyclin B1 | TGGGAGAGACATAAACGG | TGGAAGCCAAGAGCAGTG |
PCNA | GCTGTGTAGTAAAGATGCCT | ATCTCTATGGCAACAGCTTC |
CDK2 | TCTTTGCTGAGATGGTGACCC | TAACTCCTGGCCAAACCACC |
CDKN1A | AAACGGCGGCAGACC | GCCCAAGGCAAAAGG |
Name | Forward (5’–3’) | Reverse (5’–3’) |
---|---|---|
Psi-CHECK-ACVR1B-W | ACTCTCGAGAACAACCACACACACAAAA | ATAGCGGCCGCGGATGAGAAGGTGCAACTT |
Psi-CHECK-ACVR1B-Mut | TATCTGTCCTTGTACTGCTCCCCCCCGCCC | GGGCGGGGGGGAGCAGTACAAGGACAGATA |
© 2019 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Hu, X.; **ng, Y.; Ren, L.; Wang, Y.; Li, Q.; Fu, X.; Yang, Q.; Xu, L.; Willems, L.; Li, J.; et al. Bta-miR-24-3p Controls the Myogenic Differentiation and Proliferation of Fetal Bovine Skeletal Muscle-Derived Progenitor Cells by Targeting ACVR1B. Animals 2019, 9, 859. https://doi.org/10.3390/ani9110859
Hu X, **ng Y, Ren L, Wang Y, Li Q, Fu X, Yang Q, Xu L, Willems L, Li J, et al. Bta-miR-24-3p Controls the Myogenic Differentiation and Proliferation of Fetal Bovine Skeletal Muscle-Derived Progenitor Cells by Targeting ACVR1B. Animals. 2019; 9(11):859. https://doi.org/10.3390/ani9110859
Chicago/Turabian StyleHu, **n, Yishen **ng, Ling Ren, Yahui Wang, Qian Li, **ng Fu, Qiyuan Yang, Lingyang Xu, Luc Willems, Junya Li, and et al. 2019. "Bta-miR-24-3p Controls the Myogenic Differentiation and Proliferation of Fetal Bovine Skeletal Muscle-Derived Progenitor Cells by Targeting ACVR1B" Animals 9, no. 11: 859. https://doi.org/10.3390/ani9110859